데이터셋 상세
호주
Hydromedusae of the Southern Ocean
This dataset is a document describing the 66 species of Hydromedusae found in the Southern Ocean. It lists all the known species, and with illustrated diagrams provides a guide to their taxonomic identification. It also includes general information about Hydromedusae and collection and preservation. The document is available for download as a pdf from the provided URL.
데이터 정보
연관 데이터
Pelagic Nemerteans of the Southern Ocean
공공데이터포털
This dataset is a document describing the pelagic Nemerteans of the Southern Ocean. It lists the 11 known pelagic Southern Ocean species and with illustrated diagrams provides a guide to their taxonomic identification and distribution. The document is available for download as a pdf from the provided URL.
Spring Phytoplankton Assemblages in the Southern Ocean Between Australia and Antarctica
공공데이터포털
This dataset comprises of an excel spreadsheet of data collected on the CLIVAR-SR3 cruise in November to December 2001. The spreadsheet contains plankton and carbon data. From the abstract of the referenced publication: Variations of phytoplankton assemblages were studied in November-December 2001, in surface waters of the Southern Ocean along a transect between the Sub-Antarctic Zone (SAZ) and the Seasonal Ice Zone (SIZ; 46.9-64.9 degrees S; 142-143 degrees E; CLIVAR-SR3 cruise). Two regions had characteristic but different phytoplankton assemblages. Nanoflagellates (less than 20 microns) and pico-plankton (~2 microns) occurred in similar concentrations along the transect, but were dominant in the SAZ, Sub-Antarctic Front (SAF), Polar Front Zone (PFZ) and the Inter-Polar Front Zone (IPFZ), (46.9-56.9 degrees S). Along the entire transect their average cell numbers in the upper 70 m of water column, varied from 300,000 to 1,100,000 cells per litre. Larger cells (greater than 20 microns), diatoms and dinoflagellates, were more abundant in the Antarctic Zone-South (AZ-S) and the SIZ (60.9-64.9 degrees S). In AZ-S and SIZ diatoms ranged between 270,000 and 1,200,000 cells per litre, dinoflagellates from 31,000 to 102,000 cells per litre. A diatom bloom was in progress in the AZ-S showing a peak of 1,800,000 cells per litre. Diatoms were dominated by Pseudo-nitzschia spp., Fragilariopsis spp., and Chaetoceros spp. Pseudo-nitzschia spp. outnumbered other diatoms in the AZ-S. Fragilariopsis spp. were most numerous in the SIZ. Dinoflagellates contained autotrophs (eg Prorocentrum) and heterotrophs (Gyrodinium/Gymnodinium, Protoperidinium). Diatoms and dinoflagellates contributed most to the cellular carbon: 11-25 and 17-124 micrograms of carbon per litre, respectively. Small cells dominated in the northern region characterised by the lowest N-uptake and new production of the transect. Larger diatom cells were prevalent in the southern area with higher values of N-uptake and new production. Diatom and nanoflagellate cellular carbon contents were highly correlated with one another, with primary production, and productivity related parameters. They contributed up to 75% to the total autotrophic C biomass. Diatom carbon content was significantly correlated to nitrate uptake and particle export, but not to ammonium uptake, while flagellate carbon was well correlated to ammonium uptake, but not to export. Diatoms have contributed highly to particle export along the latitudinal transect, while flagellates played a minor role in the export. This work was completed as part of ASAC project 1343 (ASAC_1343). The fields in this dataset are: Station (depth, position, date, comments) Species Cells per millilitre cell carbon - micrograms per litre
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
공공데이터포털
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).
국립해양생물자원관 해양생물보유자원 통계
공공데이터포털
책임기관 및 기탁등록보존기관에서 보유하고 있는 해양생물 보유자원 통계 정보를 제공하고 있습니다.
Southern Gulf of St. Lawrence Ecosystem Research Vessel Survey (September Survey, NAFO Division 4T) Dataset
공공데이터포털
PURPOSE: The research survey provides a fisheries-independent source of information about all marine living organisms that are captured by the fishing trawl used to obtain samples in the southern Gulf of St. Lawrence. DESCRIPTION: Tow, catch, length frequency, and biological information for fish caught during the annual September research vessel trawl surveys in the southern Gulf of St. Lawrence (NAFO Division 4T). Abundance indices and spatial distribution patterns of commercial and non-commercial groundfish. The catch data that appear in this dataset SHOULD NOT BE USED FOR ECOLOGICAL ANALYSES INVOLVING CATCH RATES. Important factors such as vessel, fishing gear and diurnal periods must be accounted for to use these data in analyses. Please contact the data custodians if you are interested in using this data for any kind of ecological analyses involving catch rates. PARAMETERS COLLECTED: abundance estimates (ecological); distribution (ecological); species counts (ecological); gear (fishing); vessel information (fishing); point (spatial) NOTES ON QUALITY CONTROL: Scientific names listed in the survey species list have been mapped to recognized standards - marine taxa have been mapped to the World Register of Marine Species (WoRMS) using their online taxon match tool. All sampling locations were plotted on a map to perform a visual check confirming that the latitude and longitude coordinates were within the described sampling area. In 2003, because of a fire aboard the Alfred Needler, the Wilfred Templeman was used for the survey. However, no comparative fishing experiments have been conducted between the Alfred Needler and the Wilfred Templeman. We are therefore unable to integrate the indices derived for 2003 to the remainder of the survey time-series. SAMPLING METHODS: Sampling Method: Consult the "Protocols for research vessel cruises within the Gulf Region (dermersal fish) (1970-1980)" report, link provided in the citations list. USE LIMITATION: To ensure scientific integrity and appropriate use of the data, we would encourage you to contact the data custodian.
해양수산부 공동활용체계 해조류해초류분포
공공데이터포털
이 데이터는 해양수산부에서 해조류해초류분포에 대한 정보를 제공하기 위해 수집한 데이터입니다. 본 데이터의 주요 내용은 공간정보일련번호, 해조류해초류분포주소, 해조류해초류분포행정구역시도, 해조류해초류분포어업권, 해조류해초류분포어업권유형, 해조류해초류분포어업방법내용, 해조류해초류분포양식유형 등의 데이터로 구성되어 있습니다. 본 데이터는 해조류해초류분포 정보 확인을 통한 다양한 해양 행정 및 정책 업무를 위한 기초 자료로 활용될 수 있습니다. 해조류는 바다에 사는 모든 광합성 생물을 통칭하는 넓은 개념이고, 해초류는 그 안에 포함되는 특정 그룹을 의미합니다. 본 데이터는 해양수산발전기본법 제32조 및 해양수산정보 공동이용 종합계획에 따라 대국민 데이터 개방 확대 및 이용 촉진, 정책활용 지원 목표를 위해 수집, 관리되고 있는 데이터 입니다.
Salish Sea
공공데이터포털
Fisheries and Oceans Canada (DFO) has been conducting surface water trawl surveys since 1992 in the coastal waters of British Columbia, Washington, Oregon and Alaska and in the high seas of the Gulf of Alaska. These surveys initially focused on determining the migratory patterns (1992-2002) and on the growth and physiology (2003-2016) of juvenile Pacific Salmon. Since 2016, these surveys have been broadened to monitor the whole pelagic ecosystem, retaining a focus on juvenile Pacific Salmon. Data were collected from sites in the inland sea waters of British Columbia and Washington State, USA, that comprise the Strait of Georgia, Strait of Juan de Fuca and Puget Sound since 2001 and are ongoing.
Aquatic Substrate Library - Rottnest Marmion Shoalwater 2006-2007
공공데이터포털
Record for source data hosted in the National Spectral Database (NSD) Aquatic Library Citation: Harvey MJ (2009) Development of techniques to classify marine benthic habitats using hyperspectral imagery in oligotrophic, temperate waters [PhD thesis p280]. Perth, Western Australia: Murdoch University. 280 p. For further information and instructions to access the database go to the following URL: https://cmi.ga.gov.au/data-products/dea/643/australian-national-spectral-database
Aquatic Substrate Library - Rottnest Marmion Shoalwater 2006-2007
공공데이터포털
Record for source data hosted in the National Spectral Database (NSD) Aquatic Library Citation: Harvey MJ (2009) Development of techniques to classify marine benthic habitats using hyperspectral imagery in oligotrophic, temperate waters [PhD thesis p280]. Perth, Western Australia: Murdoch University. 280 p. For further information and instructions to access the database go to the following URL: https://cmi.ga.gov.au/data-products/dea/643/australian-national-spectral-database
Aquatic Substrate Library - Rottnest Marmion Shoalwater 2006-2007
공공데이터포털
Record for source data hosted in the National Spectral Database (NSD) Aquatic Library Citation: Harvey MJ (2009) Development of techniques to classify marine benthic habitats using hyperspectral imagery in oligotrophic, temperate waters [PhD thesis p280]. Perth, Western Australia: Murdoch University. 280 p. For further information and instructions to access the database go to the following URL: https://cmi.ga.gov.au/data-products/dea/643/australian-national-spectral-database