데이터셋 상세
호주
Microscopy imaging of live Antarctic krill (Euphausia superba)
Microscopy imaging of live Antarctic krill using a Leica M205C dissecting stereo-microscope with a Leica DFC 450 camera and Leica LAS V4.0 software. Krill were held in a custom made 'krill trap', details provided in manuscript in section eight of this form. The data are available as a single video file. These data are part of Australian Antarctic Science (AAS) projects 4037 and 4050. Project 4037 - Experimental krill biology: Response of krill to environmental change The experimental krill research project is designed to focus on obtaining life history information of use in managing the krill fishery - the largest Antarctic fishery. In particular, the project will concentrate on studies into impacts of climate change on key aspects of krill biology and ecology. Project 4050 - Assessing change in krill distribution and abundance in Eastern Antarctica Antarctic krill is the key species of the Southern Ocean ecosystem. Its fishery is rapidly expanding and it is vulnerable to changes in climate. Australia has over a decade of krill abundance and distribution data collected off Eastern Antarctica. This project will analyse these datasets and investigate if krill abundance and distribution has altered over time. The results are important for the future management of the fishery, as well as understanding broader ecological consequences of change in this important species.
데이터 정보
연관 데이터
Supplementary video for 'Internal physiology of live krill revealed using new aquaria techniques and mixed opticalmicroscopy and optical coherence tomography (OCT) imaging techniques'
공공데이터포털
This video is supplementary data for the publication entitled 'Internal physiology of live krill revealed using new aquaria techniques and mixed optical microscopy and optical coherence tomography (OCT) imaging techniques'. The video is high resolution microscopy video of a live krill captured in the krill containment trap placed within the water bath. File size: 1.8 GB, 32 s duration. The optical microscopy was carried out using a Leica M205C dissecting stereomicroscope with a Leica DFC 450 camera and Leica LAS V4.0 software to collect high-resolution video. The experimental krill research project is designed to focus on obtaining life history information of use in managing the krill fishery - the largest Antarctic fishery. In particular, the project will concentrate on studies into impacts of climate change on key aspects of krill biology and ecology.
Surface krill sampling in relation to environmental condition collected during the SIPEX II voyage of the Aurora Australis, 2012
공공데이터포털
We checked each site by taking ice cores and observing the algae biomass to determine the likelihood of krill living under the sea ice in each location. We also used a Remotely Operated Vehicle (ROV) with cameras attached to observe the abundance of krill under the sea ice. If krill were present we used on the sea ice floe a zooplankton pump, called MASMA, according to Meyer et al. 2009, whereas at the edge of the floe column a custom-built fish pump system was used to collect krill near the surface. The Aqualife Biostream BP40 fish pump was capable of pumping up to 1300 litres per minute without harming animals that pass through the pump. For much of the voyage it was operated from the ctd room and at this increased suction head it ran at about 500 litres per minute. Krill were caught at ice stations 2, 6, 7 and 8. The Krill Sample-Overview.xls file contains information regarding how many krill were caught at each ice stations, who was involved and related information. The SIPEX II Krill Voyage Report.docx contains information about the various issues that were encountered during the voyage. It also contains information from the Bottom Krill experiment, which has its own dataset and metadata record. It is duplicated in both datasets. The larvae were used for a growth experiment using the IGR method and after length measurements frozen for carbon, nitrogen, lipids, stomach and gut content analysis. The total and carapace length were determined of juveniles as well as their digestive gland size. Animals were than dissected and tissues frozen at -80C for further analysis (see above). These condition parameters will be discussed in relation to physical and biological environmental parameters of the ice floe (e.g. sea ice thickness, snow coverage, under ice topography and biomass). When this data is analysed, the dataset will be updated to include analysed versions of the data listed in the Krill Sample-Overview.xls file. Also included in the dataset are technical documents and manuals pertaining to the fish pump that was used. Meyer B et al. 2009. Limnol Oceanogr 54:1595-1614
Data to support Two scales of distribution and biomass of Antarctic krill (Euphausia superba) in the eastern sector of the CCAMLR Division 58.4.2 (55°E to 80°E)
공공데이터포털
This data may be used to reproduce the analyses (including figures and tables), of 'Two scales of distribution and biomass of Antarctic krill (Euphausia superba) in the eastern sector of the CCAMLR Division 58.4.2 (55°E to 80°E)'. The data describe krill biomass density distribution and krill net samples (krill total length and krill wetmass) collected during the 2021 TEMPO voyage on R/V Investigator. During the TEMPO voyage krill biomass was estimated using observations from two sampling instruments: a calibrated EK80 scientific echosounder operating at 120 kHz and an rectangular midwater trawl (RMT 1+8). The supporting data sets, all in CSV format, are split by instrument type. The EK80 has two datafiles: krill_density.csv – krill areal density from the TEMPO transects, and krill_swarms.csv -krill swarms detected during the TEMPO transects. The RMT1+8 has four datafiles net_locations.csv krill_lengths.csv krill_wet_mass_to_length.csv krill_wet_mass_to_length_model_predictions.csv The fields (columns) in each data file are: krill_density.csv "lat_M" – centre latitude of an echo integration interval [degrees] (dd.ddddd) WGS84 spheroid (GPS latitude) "lon_M" - centre longitude of an echo integration interval [degrees] (dd.ddddd) WGS84 spheroid (GPS longitude), "areal_biomass_density_g_per_m2" – Echo integration interval krill areal biomass density [g wet-mass / m^2] "daynight" – flag for when the sampling took place [day/night] "survey" – Either the main survey for the TEMPO biomass survey or the smaller-scale ‘Mawson box’ survey krill_swarms.csv "transect" – transect number "lat" – latitude [degrees] (dd.ddddd) WGS84 spheroid (GPS latitude) "swarm_depth_m" – mean depth of a krill swarm [m] "daynight" – flag for when the sampling took place [day/night] ”volumetric_density_g_per_m3" – krill swarm internal volumetric biomass density [g wet-mass / m^3] net_locations.csv "station" – Station name for net trawl R for routine haul, T for target trawl "lat" – mean latitude of a net trawl [degrees] (dd.ddddd) WGS84 spheroid (GPS latitude) "lon" – mean longitude of a net trawl [degrees] (dd.ddddd) WGS84 spheroid (GPS longitude) "daynight" – flag for when the sampling took place [day/night] krill_lengths.csv "station" – Station name for net trawl R for routine haul, T for target trawl "total_length_mm” – total length of an individual krill [mm] krill_wet_mass_to_length.csv "total_length_mm" – total length of an individual krill [mm] "wet_mass_g" - wet-mass an individual krill [g] krill_wet_mass_to_length_model_predictions.csv "total_length_mm" - total length of an individual krill [mm] "predicted_wet_mass_g" – predicted mean wet-mass an individual krill of length ("total_length_mm" ) [g] "LB_wet_mass_g" – Lower bound (lower 95% confidence interval) for the predicted_wet_mass_g [g] "UB_wet_mass_g"– Upper bound (upper 95% confidence interval) for the predicted_wet_mass_g [g]
Modelling growth and reproduction of Antarctic krill, Euphausia superba, based on temperature, food and resource allocation amongst life history functions
공공데이터포털
This model was produced as part of Australian Antarctic Science project 4037 - Experimental krill biology: Response of krill to environmental change - The experimental krill research project is designed to focus on obtaining life history information of use in managing the krill fishery - the largest Antarctic fishery. In particular, the project will concentrate on studies into impacts of climate change on key aspects of krill biology and ecology. This metadata record is to reference the paper that describes the model. There is no archived data output from this data product. Taken from the abstract of the referenced paper: Estimates of productivity of Antarctic krill, Euphausia superba, are dependent on accurate models of growth and reproduction. Incorrect growth models, specifically those giving unrealistically high production, could lead to over-exploitation of the krill population if those models are used in setting catch limits. Here we review available approaches to modelling productivity and note that existing models do not account for the interactions between growth and reproduction and variable environmental conditions. We develop a new energetics moult-cycle (EMC) model which combines energetics and the constraints on growth of the moult-cycle. This model flexibly accounts for regional, inter- and intra-annual variation in temperature, food supply, and day length. The EMC model provides results consistent with the general expectations for krill growth in length and mass, including having thin krill, as well as providing insights into the effects that increasing temperature may have on growth and reproduction. We recommend that this new model be incorporated into assessments of catch limits for Antarctic krill.
Light microscopy images taken onboard KAXIS V3 2015/2016
공공데이터포털
Samples were collected using a prototype basket sampler that concentrated phytoplankton from the underway water supply in the OG lab onboard Aurora Australis. The sampler filtered water during transit, and the distance travelled and the approximate volume of water sampled was recorded. A phytoplankton net tow was collected at each station. The majority of imaging was undertaken using a Leica DMLB2 microscope with phase contrastand Leica ICC50 digital in body camera. Samples were preserved with either glutaraldhyde or Lugols iodine for later examination as well. Details of sample collected are included in the Voyage sample log.
Circumpolar Projections of Antarctic krill (Euphausia superba) growth potential
공공데이터포털
These data represent the results of the first study to use Earth System Model (ESM) outputs of SST and chlorophyll-a to simulate circumpolar krill growth potential for the recent past (1960-1989) and future climate change scenarios (2070-2099). Growth potential is obtained using an empirically-derived krill growth model (Atkinson et al. 2006, Limnol. Oceanogr.), where growth is modeled as a function of SST and chlorophyll-a. It serves as an approximation of habitat quality, as areas that support high growth rates are assumed to be good habitat (see Murphy et al., 2017, Sci Rep). To increase confidence in the future projections, ESMs were selected and weighted for each season based on their skill at reproducing observation-based krill growth potential for the recent past. First, eleven ESMs which provided SST and chlorophyll-a outputs were obtained from the Coupled Model Inter-comparison Project 5 archive. These included: CanESM2, CMCC-CESM, CNRM-CM5, GFL-ESM2G, GFDL-ESM2M, GISS-E2-H-CC, HadGEM2-CC, IPSL-CM5A-LR, MPI-ESM-MR, MRI-ESM1 and NorESM1-ME. For each ESM, seasonal surface averages of SST and chlorophyll-a were used to calculate growth potential for the historical scenario (1960-1989), which was then bilinearly interpolated on to the same 1°x1° grid. Satellite observation-based datasets for SST and chlorophyll-a were used to calculate observation-based growth potential for the recent past (1997-2010). These comprised seasonal surface averages of SST (from the OISST v2 daily dataset, 1/4⁰ horizontal resolution) and chlorophyll-a (the mean of the SeaWiFS and Johnson et al. (2013) corrected estimate of SeaWiFS daily datasets, 1/12⁰ horizontal resolution). Observation-based growth potential was then bilinearly interpolated onto the same grid as the ESMs. ESM skill for each season was subsequently assessed against observation-based growth potential using a Taylor Diagram. The ESMs were selected and weighted according to their performance to produce a weighted subset (see "ESM_weighting_method.pdf" file). Of the netcdfs provided, "hist_mean_ensemble.nc" represents the unweighted mean of seasonal growth potential, calculated from the initial ensemble of eleven ESMs for the historical scenario. The "hist_mean_subset.nc" file represents the analogous output of the weighted subset. Future projections of seasonal growth potential for Representative Concentration Pathways (RCPs) 4.5 and 8.5 were obtained using the weighted subset for the period of 2070-2099. These projected seasonal surface averages are provided in the "rcp45_mean_subset.nc" and "rcp85_mean_subset.nc" files. RCPs represent standard climate change scenarios developed by the Intergovernmental Panel on Climate Change, with 4.5 reflecting some mitigation of carbon emissions, and 8.5 being the "business as usual" scenario. Analogous netcdfs for the weighted subset outputs of chlorophyll-a (chl) and SST (tos) for the historical and RCP scenarios are also provided in the "chl_tos_netcdfs.zip" file so that the driving environmental variables underlying growth potential can be examined.
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
공공데이터포털
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).
Visual sightings of krill swarms at the sea surface from the Aurora Australis during the BROKE-West voyage, 2005-2006
공공데이터포털
A collection of data files detailing visual sightings of krill swarms on the sea surface from the Aurora Australis during the BROKE-West voyage, 2005-2006. These data were additional data collected by whale observers. See the record, "BROKE-West_Cetaceans" for full details on the process of collecting whale observations. In summary though, observers were present from the time the vessel departed Fremantle until it approached Hobart. Observers worked whenever light, weather and sea conditions permitted. Generally between two and five observers were working at any given time (see the above cetaceans metadata record for more information). The download file contains: - GIS shapefiles showing the locations of the recorded swarms on the ship's track. - A csv and Excel file of the recorded observations. - Several map images showing the ship's track and the observed swarms. The BROKE-West survey was conducted on voyage 3 of the Aurora Australis during the 2005-3006 season. It was intended to be a comprehensive biological and oceanographic survey of the region between 30 degrees and 80 degrees east.
Krill Camera Footage and Traps from the SIPEX II Voyage of the Aurora Australis
공공데이터포털
The intention of the Deep Krill Camera and Trap System was to monitor and capture krill found during deep CTD operations. Two traps were installed on the CTD in place of Niskin Bottles. At pre-determined depths an internal light was illuminated and the traps were opened. After a set period of time a second trigger signal was sent to the traps, closing the entry point, encapsulating any Krill that were inside. The Krill Camera system was installed onto the CTD rosette. It consisted of a high-definition video camera (a GoPro Hero 2) within a pressure housing, flanked by two LED light sources. The power for this system was supplied via a rechargeable battery pack also mounted to the CTD. The camera system was remotely controlled from the surface via the CTD communications link. At specific depths the lights and camera were activated, recording the water column and ocean floor by adjusting focus length for fixed durations in an attempt to document Krill at lower depths. An additional camera was introduced into the system, mounted to allow video capture of the Krill Trap Operation. This camera was set to record at the beginning of the operations and left running for the duration of the deployment. Video data from the Krill camera is in MTS format, which can be opened with VLC Media Player. Trap footage is recorded in MP4 format, which can be opened with Quicktime or VLC Media Player. Trap triggering and camera operation data was recorded manually by Rob King.
Scientific echosounder data provide a predator’s view of Antarctic krill (Euphausia superba)
공공데이터포털
Raw and processed acoustic data were collected in East Antarctica from the RSV Aurora Australis during two surveys: the Krill Availability, Community Trophodynamics and AMISOR Surveys (KACTAS) and the Krill Acoustics and Oceanography Survey (KAOS) in the East Antarctic. Seabed alias example file used to make Figure 3. 38_false_bottom.sv.csv (file size: 10.7 MB) This file is an example of seabed aliasing (false bottom echo) that occurred during the KAOS survey. The data in this file are acoustic (mean volume backscattering strength, Sv) sample-by-sample and in a CSV format. Ping_index - ping number Distance_GPS - along track distance from the vessel’s GPS (nautical miles). Distance_vl - along track distance from the vessel’s log (nautical miles). Not used here, so is populated by Echoview’s ‘don’t care’ value (-9.90E+37) to keep the file format consistent. Ping_date - format yyyy-mm-dd Ping_time - format hh:mm:ss Ping_milliseconds - format (integer; ms) Latitude - position from the vessel’s GPS (degrees) Longitude position from the vessel’s GPS (degrees) Depth_start - start depth of vessel echosounder logging range (m) Depth_stop - stop depth of vessel echosounder logging range (m) Range_start - start range of vessel echosounder logging range (m) Range_stop - stop range of vessel echosounder logging range (m) Sample_count number of samples in a ping. Acoustic Sv samples follow in column-wise vector (dB re 1 m-1) Transect metadata all_transects.csv (file size: 14.8 K) This is the transect metadata for both the KACTAS and KAOS surveys: Transect - transect number startDate - start date of transect dd/mm/yyyy startTime - start time of transect hh:mm endDate - end date of transect dd/mm/yyyy endTime - end time of transect dd/mm/yyyy Ping_subset - a ping subset specified between two timestamps to isolate acoustic data that occurred on transect , i.e start timestamp to stop timestamp (yyyy-mm-dd hh:mm = yyyy-mm-dd hh:mm). Direction - Direction traveled along the transect (N - north or S- south). Light - day or night when transect was observed Survey - Either KACTAS or KAOS Leg - Krill box 1 or 2 (there were two surveys only during the KAOS voyage). Pass - Sampling bout for a transect in a given direction. Example R-code FigureAndDataprocessingExample.R (12KB) This R-code provides examples of scripting acoustic data processing using EchoviewR, specifically, using ping-subsets to isolate acoustic data along a transect of interest, detecting schools and exporting echo integrations for 38, 120 and 200 kHz. The R-code for making the figures in the paper is also given. GPS vessel positions for both the KACTAS and KAOS surveys KACTASandKAOS_GPS.csv (3 MB) This CSV file gives the vessel track for both the KACTAS and KAOS surveys. GPS_date - dd/mm/yyyy GPS_time - HH:MM:SS GPS_milliseconds - integer Latitude - position from the vessel’s GPS (degrees) Longitude - position from the vessel’s GPS (degrees) x - relative grid position (x) used for plotting Figure 1 y - relative grid position (y) used for plotting Figure 1 Survey - either: KACTAS_Krillbox, KAOS_Krillbox1, or KACTAS_Krillbox2 Krill swarms for both the KACTAS and KAOS surveys KACTASandKAOSswarms.csv (2.1 MB) Krill swarms descriptors for the KACTAS and KAOS surveys in CSV format (see Table 2 for description of the data fields). Echoview file for the KACTAS survey KACTAS-survey.EV (21.8 MB) An Echoview file (version 12.0) for the KACTAS acoustic data analysis KACTAS EK60 scientific echosounder calibration values KACTAS_EK500_calibration.ecs 3,623 16/05/2022 21:21 -a-- An Echoview format calibration file for the KACTAS survey (see Table 3 for calibration values and Demer et al.20 for a description of the calibration parameters). Echoview file for the KAOS survey KAOS-survey.EV (16.4MB) An Echoview file (version 12.0) for the KAOS acoustic data analysis KAOS EK60 scientific echosounder calibration values KAOS_EK60_calibration.ecs 5,711 01/11/2021 04:36 -a– An Echoview format calibration