데이터셋 상세
호주
Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates
These spreadsheets provide the sequences counts for the DNA groups found in the scats of Shy Albatross at Albatross Island, Tasmania, Australia. Samples were collected during three stages of the breeding season: Incubation (Late September 2014), Brood (December 2014) and Chick-rearing (March 2014 and 2015). Scat samples were collected from breeding birds, chicks and non-breeders. 'Breeders' were identified as individuals incubating an egg or attending a chick, whereas 'non-breeders' were usually pairs that had reoccupied the colony and were building new practice nests with no chick present. Non-breeders in the colony include immature birds that have not yet bred and mature birds of breeding age that did not breed in a particular season (e.g. no partner or insufficient body condition) Details of the molecular methods and synthesis of this data can be found in: McInnes, J.C., Alderman, R., Deagle, B.E. Lea, M-A., Raymond, B. and Jarman, S.N. 2016. Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates. Methods in Ecology and Evolution.
데이터 정보
연관 데이터
Southern Ocean eDNA metabarcoding raw sequencing data, collected on the Aurora Australis 2019-2020
공공데이터포털
On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file ‘V1 2019 Samples.xlsx’. Each sample pair consisted of one 2 L sample filtered through a 0.45 μm pore size filter, and one 12 L sample filtered through a 20 μm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 ˚C. Filters of the 12 L samples were stored whole and also frozen at -80 ˚C. DNA of all samples was extracted at the specialised lab ‘eDNA frontiers’ located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples: - A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 °C for 10 min, a 16 cycle touchdown phase (62 °C -1 °C per cycle), followed by 25 cycles with an annealing temperature of 46 °C (total of 41 cycles), and a final extension at 72 °C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 °C for 10 min, 10 cycles of 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI dual tagged’. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI fusion tagged’. - A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Fish’. - A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Mammal’. - A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer
Environmental DNA metabarcoding for monitoring metazoan biodiversity in Antarctic nearshore ecosystems
공공데이터포털
Our aim was to compare water and sediment as sources of environmental DNA (eDNA) to better characterise Antarctic benthic communities and further develop practical approaches for DNA-based biodiversity assessment in remote environments. We used a cytochrome c oxidase subunit I (COI) metabarcoding approach to characterise metazoan communities in 26 nearshore sites across 12 locations (including Ellis Fjord, Warriner Channel, Hawker Channel, Abatus Bay, Powell Point, Shirokaya Bay, and Weddell Arm) in the Vestfold Hills (East Antarctica) based on DNA extracted from either sediment cores or filtered seawater. We detected a total of 99 metazoan species from 12 phyla (including nematodes, cnidaria, echinoderms, chordates, arthropods, annelids, rotifers and molluscs) across 26 sites, with similar numbers of species detected in sediment and water eDNA samples. Please cite: Clarke LJ et al. (2021). Environmental DNA metabarcoding for monitoring metazoan biodiversity in Antarctic nearshore ecosystems. PeerJ, DOI: 10.7717/peerj.12458 This work was completed as part of the Davis Aerodrome Project (DAP).
Euphausiid-specific metabarcoding data from eDNA samples collected on the TEMPO voyage
공공데이터포털
This is a Euphausiid-specific metabarcoding dataset of Southern Ocean eDNA samples collected on the TEMPO voyage in 2021. We collected eDNA samples by filtering five litres of seawater in the East Antarctic Southern Ocean from the surface and seafloor as well as in and near krill swarms(n = 110). After DNA extraction, a Euphausiid-specific metabarcoding marker was used to determine the presence of different Southern Ocean krill species in each sample. Detailed methods are available in the following publication: Suter L et al. (2025) Monitoring Antarctic krill (Euphausia superba) distribution in the Southern Ocean: environmental DNA (eDNA) adds to the toolbox. Frontiers in Marine Science. The data provided here contains - raw paired end sequencing data in fastq format for each sample - R markdown code to process the raw data in order to identify unique sequences, and which sequences are contained in which samples - a tag file that identifies which multiplex-identifier (MID) tags were used in forward and reverse primers for each sample - a zOTU table that identifies which sequences were detected in each sample, and what taxonomy was associated with each sequence.
High occurrence of jellyfish predation by black-browed and Campbell albatross identified by DNA metabarcoding
공공데이터포털
This spreadsheet provides the sequences counts for the DNA groups found in the scats of black-browed albatross at New Island and Steeple Jason Island, Falkland Islands; Diego Ramírez and Albatross Islet, Chile; Bird Island, South Georgia; Canyon des Sourcils Noirs, Kerguelen Archipelago, France; Macquarie Island, Australia; and Campbell albatross at Campbell Island, NZ. Scat samples were collected in 2013/14 and 2014/15 at New Island, Steeple Jason Island, Macquarie Island, Campbell Island and Bird Island; in 2013/14 and 2015/16 at Kerguelen; in 2014/15 and 2015/16 at Albatross Islet and in 2013/14 at Diego Ramírez. Samples were collected during Incubation (Oct-Nov), early chick-rearing (Dec-Jan) or late-chick rearing (Feb-Mar). Due to the availability of birds at the colony, samples were predominantly collected from adults during incubation and early chick-rearing and chicks during late chick rearing. Samples sizes were too low during this study to directly compare dietary differences between chicks and adults; however, dietary comparisons between breeding stages were examined for sites where samples were collected during multiple breeding stages. Samples were PCR amplified with a universal metazoan primer set that is highly conserved and amplifies a region of the nuclear small subunit ribosomal DNA gene (18S rDNA). Details of the molecular methods and synthesis of this data can be found in: McInnes, J.C., Alderman, R., Raymond, B., Lea, M-A., Deagle, B., Catry, P., Gras, M., Phillip, R.A., Stanworth, A., Suazo, C., Thompson, D., Weimerskirch, H., Gras. M., and Jarman, S.N. High occurrence of jellyfish predation by black-browed and Campbell albatross identified by DNA metabarcoding. Molecular Ecology.
eDNA metabarcoding data of a long-distance Southern Ocean transect - RV Aurora Australis, V1 2019
공공데이터포털
These data accompany the paper 'Long-distance Southern Ocean environmental DNA (eDNA) transect provides insights into spatial marine biota and invasion pathways for non-native species'. Samples (n=138) were collected aboard the RSV Aurora Australis on a resupply voyage between Hobart, Tasmania (42°52’54.84”S 147°20’29.76”E) and Davis Station, Antarctica (66°26’14.28”S 77°28’24.6”E) in November 2019 (Figure 1; Table A1). Two combinations of water volume and filter pore sizes were tested at each sampling location: 12 L with 20 μm, and 2 L with 0.45 μm, herein referred to as “LargeVF” and “SmallVF” respectively. Water samples were collected and filtered approximately every 4 hours (4.52 ± 0.23) via the ship’s uncontaminated seawater intake line (4 ± 2 m depth). The seawater intake line was run for 3 – 5 minutes prior to sample collection to ensure the sample collected represented the seawater surrounding the ship at the time. SmallVF water samples (2 L, n=69) were filtered using a Sentino microbiology peristaltic pump (Pall Life Sciences) through 47 mm diameter, 0.45 μm pore size polyethersulfone filter membranes (Pall Life Sciences). Simultaneously, LargeVF water samples (12 L, n=69) were filtered using a Masterflex L/S console pump system (Cole-Parmer) through 25 mm diameter, 20 μm pore size nylon filter membranes (Merck). SmallVF filter membranes (47 mm diameter) were cut in half and immediately preserved at -80°C, with one half to be analysed and one to be stored as a reserve and a form of eDNA biobanking (Jarman et al., 2018). LargeVF filter membranes were not cut in half due to their smaller diameter (25 mm) and were stored whole at -80°C. Filtration equipment was rinsed with a 10% bleach solution and freshwater from the laboratory in between every sample, and soaked for 15 minutes with 10% bleach every tenth sample. Field controls consisted of 500 mL samples (n=10) of laboratory freshwater and the 10% bleach solution used for sterilisation, taken approximately every 10 samples. DNA was extracted from the filter membrane using a DNeasy Blood and Tissue Kit (Qiagen) in an automated QIAcube (Qiagen) DNA extraction system with the following modifications: 540 μl of ATL lysis buffer, 60 μl of Proteinase K, and a 3-hour digestion at 56°C. Extraction controls were processed in parallel with all samples to detect any laboratory or between sample contamination. Final DNA extracts were eluted in 100 μl of AE buffer. DNA was amplified to target Animalia taxa using mitochondrial cytochrome c oxidase subunit I (COI) markers: m1COIintF (Leray et al., 2013) and jgHCO2198 (Geller et al., 2013), herein referred to as Leray-COI. Samples were serially diluted (1/5, 1/10 and 1/100) to optimise DNA input levels for quantitative PCR (qPCR) and remove potential PCR inhibitors. Samples were found to perform optimally with no dilution. No-template controls were included on each qPCR plate. Metabarcoding was performed using fusion-tagged primers consisting of Illumina compatible sequencing adapters, a unique 6-8 bp multiple identifier tag (MID-tag), and the Leray-COI primer. Each sample and control were processed in duplicate using the same MID tag, to reduce stochasticity for species with low amounts of template DNA. qPCR reactions (25 μl) consisted of the following concentrations: 2 mM MgCl2, 1× AmpliTaq Gold PCR buffer, 1 U AmpliTaq Gold DNA polymerase (Applied Biosystems), 0.4 μM dNTPs (Astral Scientific), 0.1 mg BSA (Fisher Biotec), 0.6 μL of 5X SYBR Green dye (Life Technologies), 0.4 μM forward and reverse primer, 4 μL of eDNA template, made to volume with Ultrapure Distilled Water (Life Technologies). qPCR amplifications were performed using a StepOnePlus Real-Time PCR System (Applied Biosystems) in a single-step process using an adjusted touchdown thermocycler protocol with conditions: 94°C for 10 min, 16 cycles of 95°C for 10 s, 62°C (-1°C per cycle) for 30 s, and 72°C for 45 s, followed by 25 cycles of 46°C for 30 s, with a final
DNA diet data collected from Adélie penguin and snow petrel scats at Béchervaise Island from 2014-2018.
공공데이터포털
Adélie penguin and snow petrel scats were collected at Béchervaise Island (67°35’S, 62°49’E) in the austral summers 2014/2015, 2017/2018 and 2019/2020 and stored in 80% Ethanol. DNA was extracted using the Maxwell RSC48 instrument with the Maxwell RSC 48 Tissue DNA Kit (Promega). ~30 mg of the scat was added to 250 μL of S.T.A.R buffer (Roche Diagnostics). All remaining steps followed the manufacturer’s instructions. Reagent blank controls (n=5) were added to the extraction process. DNA was plated out and diluted 1:5. In total, there were 465 scat samples; 302 collected from Adélie penguins and 163 from snow petrels. Three DNA markers providing different taxonomic information were amplified. 18s - All samples (n=480 includes positives and negatives) were amplified with a primer set that amplifies ~170bp of the nuclear 18S gene (McInnes et al., (2017b) DNA Metabarcoding as a Marine Conservation and Management Tool: A Circumpolar Examination of Fishery Discards in the Diet of Threatened Albatrosses. Frontiers in Marine Science). A PNA clamp was also added to suppress bird and mammal DNA . Krill - We characterised the taxonomic identity of krill by amplifying ~250bp of the 16S rDNA gene (Ratcliffe et al, (2021), Changes in prey fields increase the potential for spatial overlap between gentoo penguins and a krill fishery within a marine protected area. Diversity and Distributions). Samples were considered positive for krill if the Ct value was less than 35 (n=120). PCR amplifications were performed in two rounds, the first to amplify the target gene and add sample-specific 6 or 7 bp multiplex-identifier (MID) tags (forward and reverse primer) and Illumina sequencing primers, the second to add sequencing adapters and additional 8 bp MIDs. PCR products from all samples including the blanks, positive and negative controls (n=600) were pooled and purified using Agencourt Ampure (Beckman Coulter, USA) magnetic beads. The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with a MiSeq Reagent Kit V2 (1 x 150 bp). The 480 18S_SSU and 120 positive 16S_Krill were sequenced on one chip (n=600). -See 18s and Krill PCR excel sheet for samples, primers, 1st round PCR with MID tags, second round PCR with MID tags and miseq sheet. -See 18s and Krill folder for Fastq files In addition we also amplified 500 samples (465 scats, 17 repeats, extraction blanks, positives and negative controls) with the 16S_Fish marker (Deagle, et al (2007) Studying Seabird Diet through Genetic Analysis of Faeces: A Case Study on Macaroni Penguins (Eudyptes chrysolophus). PLOS ONE 2:e831). PCR amplifications were performed in two rounds, the first to amplify the target gene and add sample-specific 6 bp multiplex-identifier (MID) tags (forward and reverse primer) and Illumina sequencing primers, the second to add sequencing adapters and additional 8 bp MIDs. PCR products from all samples including the blanks, positive and negative controls (n=500) were pooled and purified using Agencourt Ampure (Beckman Coulter, USA) magnetic beads. The pool was diluted to 2 nM and paired-end reads generated on a MiSeq (Illumina, San Diego, CA, USA) with a MiSeq Reagent Kit V2 (1 x 150 bp). -See Fish PCR excel sheet for samples, primers, 1st round PCR with MID tags, second round PCR with MID tags and miseq sheet. -See Fish Fastq folder for Fastq files The sex of each sample was determined with a real-time melt curve analysis (Faux et al, (2014) High-throughput real-time PCR and melt curve analysis for sexing Southern Ocean seabirds using fecal samples. Theriogenology 81:870-874). Known male and female Adélie penguin, snow petrel samples and Gentoo penguin samples were included on each run. Sexing reaction mix contained 1 μM for each forward and reverse primer, 2 μg BSA, 1 x LightCycler 480 Probes Master (Roche), 1 x EvaGreen (Biotium). Thermal cycling conditions were 95 degrees for 5 min; followed by 40 cycles of 95 degrees for 10s, 55
Environmental DNA metabarcoding results of fish prey DNA in common loon (Gavia immer) fecal and cloacal swab samples from the Whitefish Chain of Lakes, Crow Wing County, Minnesota
공공데이터포털
The dataset contains sequencing read counts of fish prey eDNA metabarcoding (using primers targeting the 16S rRNA mitochondrial gene) that were extracted from fecal and cloacal swab samples collected from common loons (Gavia immer) captured on the Whitefish Chain of Lakes, Crow Wing County, Minnesota during 2015-2106. Sample type (cloacal or fecal); loon identification, age, and sex; capture date and location; and prey detections for each sample are provided.
Environmental DNA metabarcoding results of fish prey DNA in common loon (Gavia immer) fecal and cloacal swab samples from the Whitefish Chain of Lakes, Crow Wing County, Minnesota
공공데이터포털
The dataset contains sequencing read counts of fish prey eDNA metabarcoding (using primers targeting the 16S rRNA mitochondrial gene) that were extracted from fecal and cloacal swab samples collected from common loons (Gavia immer) captured on the Whitefish Chain of Lakes, Crow Wing County, Minnesota during 2015-2106. Sample type (cloacal or fecal); loon identification, age, and sex; capture date and location; and prey detections for each sample are provided.
Molecular ecology of key Southern Ocean predators
공공데이터포털
Metadata record for data from AAS (ASAC) project 2926. Public Summary DNA based approaches will be used to study key features of the ecology of whales, penguins and krill. Standard methods cannot accurately estimate what prey species these predators consume, how old they are, or how they are related to the rest of their species. This project will apply novel DNA based methods to biopsy or scat samples as a non-invasive means of improving our understanding of the diet, age and population structure of these important predators. Project objectives: The overall objective of this project is to use molecular biology to study aspects of the ecology of key Southern Ocean predators that cannot be addressed with other methodologies. The organisms that the project would focus upon have been chosen because they are large biomass components of the Southern Ocean food web and because they are important to the Australian Governments commitments to the Commission for the Conservation of Antarctic Marine Living Resources (CCAMLR) and the International Whaling Commission (IWC). This project is integral to the work of the Australian Centre for Applied Marine Mammal Science (ACAMMS) that has recently been formed within the Science Branch of the AAD. The focus predators are baleen whales (primarily Minke whales, Balaenoptera edeni and Humpback whales, Megaptera novaengliae), Antarctic krill (Euphausia superba) and Adelie penguins (Pygoscelis adeliae). Within this overall goal, there are three major objectives: To characterise and monitor predation by key Southern Ocean organisms with dietary DNA analysis. To use population genetics to study the stock structure and population size of baleen whales and Antarctic krill. To develop and validate DNA-based age estimation methods for whales. DNA Based Dietary Research A major objective of this project is to apply DNA based methods for dietary analysis to large sample sets taken to address specific ecological questions. My group at the Australian Antarctic Division has been at the forefront of developing DNA based methods to study animal diet. We have been especially active in researching DNA as a non-invasive means of studying the diet of large mammals and birds by reconstructing diet with prey DNA that we can identify in scats from predators. Our development of new DNA-based methodologies (Jarman et al., 2002; Jarman et al., 2004; Deagle et al., 2005; Jarman et al., 2006a) and accompanying software tools (Jarman 2004; Jarman 2006) have led to more efficient dietary analysis methods and has produced a substantial volume of good quality published research and stimulated international interest in these methodologies, which are now being pursued by several overseas laboratories. We have completed short descriptive studies of the diet of Antarctic krill (Passmore et al., 2006), whales (Jarman et al., 2002; Jarman et al., 2004; Jarman et al., 2006b), fur seals (Casper et al., in prep) and macaroni penguins (Deagle et al., in prep) with these methods, but have not had comprehensive sets of samples with which we can address broader ecological questions. The ecological questions that the dietary component of this project will address are: 1a. What is the diversity and identity of prey species consumed by populations of the key predators? 1b. What are the relative biomass proportions of prey species consumed by key predator populations? 1c. What temporal variation is there in diversity, identity and abundance of prey consumed by each key predator population? 1d. What spatial variation is there in diversity, identity and abundance of prey consumed by each key predator population? The focus species cover three trophic levels of the Southern Ocean food web. Krill are thought to feed predominately on primary producers with some heterotrophic prey taken as well. Adelie penguins feed on krill and other small nekton and plankton, as well as being prey of leopard seals and killer whales, making them a mid-to-high level
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
공공데이터포털
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).