This dataset contains oceanographic data that was collected during the Expedition to the Deep Slope 2007 cruise in the Gulf of Mexico. CTD were collected from NOAA Ship RONALD H. BROWN and ROV JASON II. The accession also contains wet lab images, microscope images, GIS products, dive plans, and dive summaries.

이 데이터셋의 설명이 없습니다

This cruise used the remotely operated vehicle (ROV) Jason II to: explore 4-6 new sites for the occurrence of deep water coral reefs; made collections of Lophelia and other corals for genetic and physiological studies, made collections of communities associated with Lophelia and other corals for ecological studies; collected quantitative digital imagery for characterization of sites and coral communities; collect spatially explicit physical near bottom oceanographic data; deploy cameras and microbial arrays; reposition larval traps and current meters; collected push cores; and conducted a series of linked archaeological/ biological investigations on deep water shipwrecks.

The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and Voelschow, 2021) are the raw DNA sequence files referenced in the associated journal article (Kellogg and Pratte, 2021) entitled, “Unexpected diversity of Endozoicomonas in deep-sea corals.”. This dataset, PRJNA699458_16S-V3V4_raw_data_1.zip, represents the 16S rRNA gene amplicon surveys of 28 samples of deep-sea corals, including Acanthogorgia aspera (n=5), Acanthogorgia spissa (n=4), Desmophyllum dianthus (n=7), and Lophelia pertusa [Desmophyllum pertusum] (n=12), plus a kit extraction control blank. The sequencing targeted the V3-V4 variable region (primers 341F/806R) and was completed using an Illumina MiSeq sequencing system with version 2 chemistry to obtain paired-end reads.

The files in this this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) are the raw 16S ribosomal ribonucleic acid (rRNA) gene amplicon deoxyribonucleic acid (DNA) sequence files from 90 samples of tropical and cold-water corals, as well as sequence files from a mock community and extraction blanks for the kits used for DNA extraction. The mock community was sequenced in order to assess any biases in the sequencing technology, while extraction blanks were sequenced in order to identify any contaminants in the DNA extraction kits. The tropical coral samples (three species) were collected by permit (#FKNMS-2017-064) in March 2018 from a nursery in the Florida Keys National Marine Sanctuary. The cold-water coral samples (two species) were collected in August 2018 from two locations in the Atlantic Ocean.

이 데이터셋의 설명이 없습니다

이 데이터셋의 설명이 없습니다

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.