데이터셋 상세
미국
Sub-lethal and Lethal Methods to Detect Recent Imidacloprid Exposure in Birds with Application to Field Studies
The dataset includes information on birds used in the study and the samples collected as well as imidacloprid and imidacloprid metabolite data. The first author should be contacted prior to using these data at charlotte.roy@state.mn.us. Citation information for this dataset can be found in the EDG's Metadata Reference Information section and Data.gov's References section.
데이터 정보
연관 데이터
Toxicological responses to sublethal anticoagulant rodenticide exposure in free-flying red-tailed hawks
공공데이터포털
Entity 1 provides data on 1. RTHAs (Treatment, ID, Origin, Sex, Mate, Initial body weight, Body weight at release and Change in body weight during the CPN exposure period). 2. ICPN exposure (Amount of BTPD consumed per day per hawk and CPN residue concentrations in BTPD livers). 3. RTHA response to CPN exposure (Coagulopathy, Ptiloerection duration and frequency, and the number of days that free-flying RTHAs were detected or not detected. Entity 2 provides data of: 1. CPN residue concentrations in livers of control BTPDs and CPN residue concentrations in livers of the control BTPDs after some of the samples were reanalyzed with three blanks between samples.
Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset
공공데이터포털
Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected. CO1 primers with Illumina adaptors: CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393
Methylmercury effects on birds: Bibliography and dataset for the development of toxicity reference values for injury assessment
공공데이터포털
This data release contains three files. The first (Table S1 Bibliography Dataset) contains the entire bibliography for the 435 publications examined for potential inclusion into at least one of the meta-analyses for the effects of environmental mercury (Hg) on birds. For those 168 publications that were included in at least one meta-analysis, the worksheet titled Bibliography contains data describing each sub-dataset, including the type of study, data extraction methods, biological endpoints measured, age class, tissue-residue Hg concentrations, dosing Hg concentrations, the measured effect of Hg, bird taxonomy, life history, and the study’s citation. The worksheet titled Header Explanation describes each column within the Bibliography. The worksheet titled Flowchart describes the process of how the different columns within the Bibliography worksheet can be filtered to produce the studies and sub-datasets that were included within a specific meta-analysis (e.g., combinations of endpoint categories and age classes). The second file (Table S2 Detailed Endpoints) contains the entire list of detailed biological endpoints measured by studies examining the effect of Hg on birds and how they were categorized into the six main endpoint categories (i.e., survival, offspring output, behavior, biochemical, histology, and body morphology) and the three combined endpoints categories (i.e., combined reproduction endpoints, combined survival and reproduction endpoints, and all endpoints during the breeding season). The number of publications and sub-datasets (both for all time periods and those conducted during the breeding season) that quantified each endpoint are listed. The third (Table S3 Data Tables) contains the data used in all 87 meta analyses and shows how each row of data (datapoint used in at least one meta analysis) was categorized into the six main endpoint categories and the three combined endpoint categories. Each of the seven worksheets in the Table S3 Data Tables represents a different type of Hg on the x axis (adult blood-equivalent Hg, egg-equivalent Hg, Hg injected into eggs, maternal dietary Hg for effects on eggs, maternal dietary Hg for effects on juveniles, adult dietary Hg for effects on adults, and juvenile dietary Hg for effects on juveniles).
Residue data release for manuscript entitled: Toxicokinetics of imidacloprid-coated wheat seeds in Japanese quail (Coturnix japonica) and an assessment of risk
공공데이터포털
- Observations of test subjects, - Body weight, organ/tissue weights - Biomarker data (oxidative DNA damage, thyroid hormones, corticosterone, gene expression) in various tissues - Residues as percent of administered dose - Tissues to plasma rations - Metabolites and ratios - Elimination half-lives
Residue data release for manuscript entitled: Toxicokinetics of imidacloprid-coated wheat seeds in Japanese quail (Coturnix japonica) and an assessment of risk
공공데이터포털
- Observations of test subjects, - Body weight, organ/tissue weights - Biomarker data (oxidative DNA damage, thyroid hormones, corticosterone, gene expression) in various tissues - Residues as percent of administered dose - Tissues to plasma rations - Metabolites and ratios - Elimination half-lives
Using Pop-GUIDE to Assess the Applicability of MCnest for Relative Risk of Pesticides to Hummingbirds
공공데이터포털
- Text description of regulatory methods for estimating nectar and pollen concentrations from soil applications and seed treatments; - Table S1: Parameter set for imidacloprid used for simulations to assess the relative risk of neonicotinoid pesticides to hummingbirds. - Table S2: Full sensitivity results for ruby-throated hummingbird exposure to imidacloprid simulation - Table S3: Data used for estimating the Mineau scaling factor for imidacloprid. This dataset is associated with the following publication: Etterson, M., E. Paulukonis, and S. Purucker. Using Pop-GUIDE to Assess the Applicability of MCnest for Relative Risk of Pesticides to Hummingbirds. Ecologies. MDPI, Basel, SWITZERLAND, 4(1): 171-194, (2023).