We use RNA sequencing to investigate which genetic/physiological pathways in Antarctic krill are affected by increased CO2 levels. We carried out larval CO2 exposure experiments in March 2012 at the AAD aquarium. Two developmental stages were used (Calyptopis I and Furcilia V) and three CO2 levels (control, 1000 and 2000 ppm). These were short term experiments (2 days) - since initial longer experiments starting with fertilized eggs resulted in differences in developmental stages between treatments and control which could confound the data. RNA was extracted from larvae and high-throughput RNA sequencing (RNA-seq) was carried out on 6 samples (2 stages * 3 treatments). Sequencing was carried out on an Illumina sequencer (Genome Analyzer II). We collected ~ 60 million sequence reads per sample (Data in FASTA format each read gives 100 base pairs of sequence), so a total of ~360 million reads (36 billion bp of data).

This metadata record was created in error and a DOI assigned to it before the error was noticed. The correct metadata record is available here: https://data.aad.gov.au/metadata/records/AAS_4015_Krill_Gonad_Transcriptome with the DOI doi:10.26179/5cd3c8fec9ad8.

On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file ‘V1 2019 Samples.xlsx’. Each sample pair consisted of one 2 L sample filtered through a 0.45 μm pore size filter, and one 12 L sample filtered through a 20 μm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 ˚C. Filters of the 12 L samples were stored whole and also frozen at -80 ˚C. DNA of all samples was extracted at the specialised lab ‘eDNA frontiers’ located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples: - A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 °C for 10 min, a 16 cycle touchdown phase (62 °C -1 °C per cycle), followed by 25 cycles with an annealing temperature of 46 °C (total of 41 cycles), and a final extension at 72 °C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 °C for 10 min, 10 cycles of 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI dual tagged’. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI fusion tagged’. - A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Fish’. - A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Mammal’. - A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).

This metadata record is a parent for all data on Antarctic blue whales collected during the 2015 New Zealand-Australia Antarctic Ecosystems Voyage. Description of specific data sets can be found in the Voyage Science Plan and within child datasets.

Population connectivity and gene flow in near shore Antarctic Echinoids (Sterechinus neumayeri, Abatus nimrodi and Abatus ingens) was investigated in East Antarctica. This data set consists of microsatellite genotype data from 11 novel loci and mitochondrial DNA sequences from two gene region, COI and 16S. In addition, to determine if changes in temperature and salinity impacted fertilisation success in S. neumayeri, and to determine the appropriate sperm to egg ratio for this type of experiment, a fertilisation experiment was completed using various combinations of temperature, salinity and sperm to egg ratio. Samples were collected near two Australian Antarctic research stations, Casey and Davis, during the 08/09 and 09/10 summer field seasons. To generate the microsatellite data set, a total of 545 adults, nuemayeri and 26 echinoplutei were collected. Spatial replication was achieved by comparing adult populations between two regions (Casey and Davis). These two regions are separated by approximately 1400 km. Sampling in the Casey region was done at two locations 9 km apart and in the Davis region at five locations separated by 5 - 30 km. Within each location 25-50 individuals were collected from up to three sites approximately 0.5 km apart. Within each site, all individuals were collected within an area less than 50 m2. Adult urchins were collected by dip nets, snorkel or scuba depending on location. Echinoplutei were collected from the water column in two locations in the Davis region using a purpose built plankton net. DNA was extracted using QiagenDNeasy Blood and Tissue extraction kits as per the manufacturer's protocols. PCR amplification was carried out in four multiplex reactions and analysis of the PCR product was carried out on a CEQ 8000 (Beckman Coulter) automated sequencer by capillary separation, and alleles scored as fragment size using CEQ 8000 Genetic Analysis System software (ver. 8.0). Data available: Data consists of 571 individual genotypes at 11 loci in an excel spreadsheet following the GenAlEx v 6.41 layout. Sites from the Davis region are; Old Wallow 1 (OW1), Old Wallow 2 (OW2), Boyd Island (BO1), Ellis Fjord 1 (EL1), Ellis Fjord 2 (EL2), Ellis Fjord 3 (EL3), Trigwell Island 1 (TR1), Trigwell Island 2 (TR2), Trigwell Island 3 (TR3), Zappit Point 1 (ZP1), Zappit Point 2 (ZP2), Zappit Point 3 (ZP3). Sites from the Casey region are; Browning Peninsula 1 (CB1), Browning Peninsula 2 (CB2), Browning Peninsula 3 (CB3), Sparkes Bay 1 (CS1), Sparkes Bay 2 (CS2).Echinoplutei samples are Hawker Island (D1); Kazak Island 1 (K1); Kazak Island 2 (K2) Data is coded as fragment length, with a zero value representing no data. To generate the mtDNA sequence data, a total of 24 S. neumayeri individuals were sequenced for the COI gene region with two haplotypes found. For the 16S gene region, 25 individuals were sequenced with three haplotypes founds. For Abatusingens, 51 individuals were sequenced with six CO1 haplotypes and five 16S haplotypes. For Abatus nimrodi (n = 48) there were two CO1 haplotypes and eight 16S haplotypes. In addition, eight A. shackeltoni, four A. philippii and one A. cavernosus sample were included from the Davis region. Data available: data are available in four FASTA text format files, one for Abatus COI data, one forAbatus 16S data, one for Sterechinus COI data. Individuals are coded with the first two letters representing species (SN = S. neumayeri, AN = A. nimrodi, AI = A. ingens, AS = A. shackletoni, AC= A. cavernosus) the next two representing gene region (CO = COI, 16 = 16S) and either three or four more digits for Davis region samples or five digits beginning with 41 for Casey region samples. To generate the fertilisation data set, S. neumayeri were collected from Ellis Fjord prior to ice breakout. A total of 12 individuals were screened for the fertilisation experiment, seven males and five females to ensure a suitable cross where greater than 90% fertilisation success was achievable.

Biopsy samples were collected from humpback (n=10) and blue whales (n=1) during the NZ/Aus Antarctic Ecosystems Voyage 2015. Biopsy collection from humpback and blue whales was attempted from the bow of the ship using Larsen rifles. Biopsying blue whales from the bow of the RV Tangaroa proved challenging due to the ship’s manoeuvrability and the limited capacity to change speed rapidly. Biopsy samples were split between All Protect (Qiagen), 70% ethanol, and freezing at -20C. . This dataset consists of an excel spreadsheet (biopsy_events.xlsx) summarising biopsy events containing the fields: Date_taken (in UTC) Location (general) where sample collected Latitude Longitude Individual ID Sample ID Name of sampler Sample type Preservative used Species sampled An excel spreadsheet (Biopsy sample info datasheet AEV 2015.xlsx) details the biopsy processing that occurred upon collection of a sample. Where possible, each sample was split and preserved in 2 x All Protect, 1 x EtOH and 1 x -80 degrees Celsius. Samples preserved in All Protect and 70% ethanol are stored at the Australian Antarctic Division and samples preserved at -80C are stored at NIWA Wellington. A subsample of the Antarctic blue whale biopsy was submitted to the IWC-recognised genetic repository for Antarctic blue whale at NOAA Southwest Fisheries, La Jolla. Biopsy samples were processed to determine sex and the results are held in: TAN1502_Whale biopsy samples.xls

This restriction site associated DNA sequencing (RAD-seq) dataset for Antarctic krill (Euphausia superba) includes raw sequence data and summaries for 148 krill from 5 Southern Ocean sites. A detailed README.pdf file is provided to describe components of the dataset. DNA library preparation was carried out in two separate batches by Floragenex (Eugene, Oregon, USA). RAD fragment libraries (SbfI) were sequenced on an Illumina HiSeq 2000 using single-end 100 bp chemistry. As there is no reference genome for Antarctic krill, a set of unique 90 bp sequences (RAD tags) was assembled from 17.3 million single-end reads from an individual krill. We obtained over a billion raw reads from the 148 krill in our study (a mean of 6.8 million reads per sample). The reference assembly contained 239,441 distinct RAD tags. The core genotype dataset exported for downstream data filtering included just those SNPs with genotype calls in at least 80% of the krill samples and contained 12,114 SNPs on 816 RAD tags. Sample collection table (comma separated): Southern Ocean Location, Sample Size, Austral Summer, Latitude, Longitude, ID East Antarctica (Casey), 21, 2010/2011, 64S, 100E, Cas East Antarctica (Mawson), 22, 2011/2012. 66S, 70E, Maw Lazarev Sea, 38, 2004/2005 and 2007/2008, 66S, 0E, Laz Western Antarctic Peninsula, 16, 2010/2011, 69S, 76W, WAP Ross Sea, 23, 2012/2013, 68S, 178E, Ross

Voyage track information for the VWHALE voyage of the Australian Antarctic program, February-March, 2013. The data are available as either NMEA files or shapefiles. Voyage objective - Whale acoustics and tagging off the ice edge of the Ross Sea Voyage duration - 30 Jan 2013 to 17 Mar 2013. Ship - Amaltal Explorer See the parent metadata record for more information about the voyage.

In March 2018, 23 environmental DNA (eDNA) samples (2 L of filtered seawater) were collected between Hobart, Tasmania and subantarctic Macquarie Island. These samples were processed using six different genetic metabarcoding markers targeting different taxonomic groups within the metazoan clade: A broad cytochrome c oxidase subunit I (COI) marker targeting all metazoans, and five different 16S markers targeting fish, cephalopods and crustaceans (one degenerate marker), fish (two markers of different lengths), cephalopods (one marker) and crustaceans (one marker). The aim of this study was to identify an ideal set of molecular markers to identify as many metazoan species as possible from small environmental samples, with a particular focus on vertebrates, crustaceans and cephalopods. The data and methods are described in the word file "V4 2018 eDNA group specific markers.docx", results are summarised in the excel file "Marker.detection.xlsx" and additional sample information is in the excel files "2018_11_07_eDNA-sample-info.xls" and "sample.map.csv". Each genetic marker used in this study has its own folder, containing the raw FASTQ sequencing data, the processed FASTA sequencing data, the bioinformatics processing pipeline, the zOTU fasta file, BLAST output, MEGAN output and curated zOTU table. For further explanations please refer to the word file "V4 2018 eDNA group specific markers.docx".