This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).

The embryonic development of Antarctic krill (Euphausia superba) is sensitive to elevated seawater CO2 levels. This data set provides the experimental data and WinBUGS code used to estimate hatch rates under experimental CO2 manipulation, as described by Kawaguchi et al. (2013). Kawaguchi S, Ishida A, King R, Raymond B, Waller N, Constable A, Nicol S, Wakita M, Ishimatsu A (2013) Risk maps for Antarctic krill under projected Southern Ocean acidification. Nature Climate Change (in press) Circumpolar pCO2 projection. To estimate oceanic pCO2 under the future CO2 elevated condition, we computed oceanic pCO2 using a three-dimensional ocean carbon cycle model developed for the Ocean Carbon-Cycle Model Intercomparison Project (2,3) and the projected atmospheric CO2 concentrations. The model used, referred to as the Institute for Global Change Research model in the Ocean Carbon-Cycle Model Intercomparison Project, was developed on the basis of that used in ref. 4 for the study of vertical fluxes of particulate organic matter and calcite. It is an offline carbon cycle model using physical variables such as advection and diffusion that are given by the general circulation model. The model was forced by the following four atmospheric CO2 emission scenarios and their extensions to year 2300. RCP8.5: high emission without any specific climate mitigation target; RCP6.0: medium-high emission; RCP 4.5: medium-low emission; and RCP 3.0-PD: low emission (1). Simulated perturbations in dissolved inorganic carbon relative to 1994 (the Global Ocean Data Analysis Project (GLODAP) reference year) were added to the modern dissolved inorganic carbon data in the GLODAP dataset (5). To estimate oceanic pCO2, temperature and salinity from the World Ocean Atlas data set (6) and alkalinity from the GLODAP data set were assumed to be constant. Marine ecosystems of the Southern Ocean are particularly vulnerable to ocean acidification. Antarctic krill (Euphausia superba; hereafter krill) is the key pelagic species of the region and its largest fishery resource. There is therefore concern about the combined effects of climate change, ocean acidification and an expanding fishery on krill and ultimately, their dependent predators—whales, seals and penguins. However, little is known about the sensitivity of krill to ocean acidification. Juvenile and adult krill are already exposed to variable seawater carbonate chemistry because they occupy a range of habitats and migrate both vertically and horizontally on a daily and seasonal basis. Moreover, krill eggs sink from the surface to hatch at 700–1,000m, where the carbon dioxide partial pressure (pCO2 ) in sea water is already greater than it is in the atmosphere. Krill eggs sink passively and so cannot avoid these conditions. Here we describe the sensitivity of krill egg hatch rates to increased CO2, and present a circumpolar risk map of krill hatching success under projected pCO2 levels. We find that important krill habitats of the Weddell Sea and the Haakon VII Sea to the east are likely to become high-risk areas for krill recruitment within a century. Furthermore, unless CO2 emissions are mitigated, the Southern Ocean krill population could collapse by 2300 with dire consequences for the entire ecosystem. The risk_maps folder contains the modelled risk maps for each of the climate change scenarios (i.e. Figure 4 in the main paper, and Figure S2 in the supplementary information). These are in ESRI gridded ASCII format, on a longitude-latitude grid with 1-degree resolution. Refs: 1. Meinshausen, M. et al. The RCP greenhouse gas concentrations and their extensions from 1765 to 2300. Climatic Change 109, 213-241 (2011). Orr, J. C. et al. Anthropogenic ocean acidification over the twenty-first century and its impact on calcifying organisms. Nature 437, 681-686 (2005). Cao, L. et al. The role of ocean transport in the uptake of anthropogenic CO2. Biogeosciences 6, 375-390 (2009). Yamanaka, Y. and Tajika, E. The role

RNA was extracted from pooled gonad tissues and tails of five sexually mature males and females, respectively, originating from the krill aquarium at the AAD in Tasmania, Australia. For RNA extractions, RNeasy mini kits (QIAGEN) were used and total RNA (8 micrograms each) was sent to Geneworks, South Australia (www.geneworks.com.au), for Illumina TruSeq 75 bp paired-end sequencing in two technical replica. Reads Yield Total Yield Krill_Male_sex_a_read1_sequence.txt 8,120,993 609,074,475 bases 1,218,148,950 bases Krill_Male_sex_a_read2_sequence.txt 8,120,993 609,074,475 bases Krill_Male_sex_b_read1_sequence.txt 10,465,586 784,918,950 bases 1,569,837,900 bases Krill_Male_sex_b_read2_sequence.txt 10,465,586 784,918,950 bases Krill_Male_tissue_a_read1_sequence.txt 7,867,804 590,085,300 bases 1,180,170,600 bases Krill_Male_tissue_a_read2_sequence.txt 7,867,804 590,085,300 bases Krill_Male_tissue_b_read1_sequence.txt 10,956,251 821,718,825 bases 1,793,118,450 bases Krill_Male_tissue_b_read2_sequence.txt 10,956,251 821,718,825 bases Krill_Female_sex_read1a_sequence.txt 29,447,654 2,208,574,050 bases 4,417,148,100 bases Krill_Female_sex_read2a_sequence.txt 29,447,654 2,208,574,050 bases Krill_Female_sex_read1b_sequence.txt 18,223,515 1,366,763,625 bases 2,733,527,250 bases Krill_Female_sex_read2b_sequence.txt 18,223,515 1,366,763,625 bases The insert size for these libraries is approx 160bp.

Long-term experiment on increased CO2 level on krill physiology. Krill were exposed to a range of CO2 conditions 400-4000ppm over a year, and their growth, mortality, and physiology were monitored. -List of files- Ericson Krill Ocean Acidification Study Raw Data_for data centre.xlsx: This file contains data on krill growth, mortality, physiology, and biochemistry, as well as information on water chemistry throughout 1 year period of the experiment. Ericson et al. Adult krill OA MS final submission.pdf: Unpublished manuscript of the experiment including all methods of the experiment.

Experimental Design A six-level, dose-response ocean acidification experiment was run on a natural microbial community from nearshore Antarctica, between 19th November and 7th December 2014. Seawater was collected from approximately 1 km offshore of Davis Station, Antarctica (68◦ 35’ S, 77◦ 58’ E), pre-filtered (200 μm), and transferred into six 650 L tanks (minicosms) located in a temperature-controlled shipping container. Six CO2 levels were achieved by altering the fugacity of carbon dioxide (ƒCO2) within each minicosms. The ƒCO2 was adjusted stepwise to the target concentrations for each minicosm (343, 506, 634, 953, 1140, 1641 μatm) over a five-day period using 0.2 μm filtered seawater enriched with CO2. This acclimation to CO2 was conducted at low light (0.9 ± 0.2 μmol m−2 s−1) so there was low growth of the phytoplankton. Light levels were then increased over a further two days to 90.52 ± 21.45 μmol m−2 on a 19:5 light/dark non-limiting light cycle. After this acclimation period, the microbial community was allowed to grow for 10 days (days 8-18), during which the ƒCO2 levels within each minicosm was adjusted daily to maintain the target ƒCO2 level for each minicosm, and light levels were kept constant. No nutrients were added during the experiment. For a more detailed description of minicosm set-up, lighting and carbonate chemistry see; Davidson, A. T., McKinlay, J., Westwood, K., Thomson, P. G., van den Enden, R., de Salas, M., Wright, S., Johnson, R., and Berry, K.:Enhanced CO2 concentrations change the structure of Antarctic marine microbial communities, Mar. Ecol. Prog. Ser., 552, 93-113, 2016. Deppeler, S. L., Petrou, K., Westwood, K., Pearce, I., Pascoe, P., Schulz, K. G., and Davidson, A. T. Ocean acidification effects on productivity in a coastal Antarctic marine microbial community, Biogeosciences, 15(1), 2018. Sample Collection Samples of 40-400 L were collected and sequentially size-fractionated filtered onto 293 mm biomass filters with 3.0 and 0.1 μm pore-sized polyethersulfone membrane filters (Pall XE20206 Disc 3.0 μm Versapor 293 mm and 656552 Disc 0.1 μm Supor 293 mm) using the design of the Global Ocean Sampling expedition (Rusch et al., 2007). Samples were collected on days 0 (immediately after seawater collection), 12 (mid-exponential growth) and 18 (end of experiment). On day 0, 400 L of seawater was collected from the reservoir tank (pre-filtered 200 μm), from which all the minicosms were filled, to allow characterisation of the initial community. This sample was collected from the reservoir, and not the minicosms, due to the large volume needed to collect sufficient microbial biomass on the filters. On day 12 and 18, 40 L was collected from each minicosm for filtration. The later samples were of a smaller volume due to the increase in biomass in the minicosms during the experiment, meaning less volume of water was required to gain sufficient material on the filters to perform molecular analysis. The filter membranes containing the concentrated microbial biomass were stored in 15 mL of storage buffer, flash frozen in liquid nitrogen and stored at - 80◦C. The storage buffer was freshly prepared on each sampling day with a mixture of 2.5 mM EGTA, 2.5 mM EDTA, 0.1 mM Tris-EDTA, RNA Later (0.5x house prepared), 1 mM PMSF and Protease Inhibitor Cocktail VI (Ng et al., 2010). Between samples the filtration apparatus was sequentially washed with 2 x 25 L 0.1 M NaOH, 2 x 25 L 0.07% Ca(OCl)2 and 2 x 25 L fresh water. All samples were stored and transported at -80◦C to the Australian Antarctic Division, Hobart, Australia for DNA extraction. DNA Extraction and Sequencing The DNA was extracted from half of each filter (3.0 and 0.1 μatm per sample) via the method described in Rusch et al. (2007). In short, the filters were cut into small pieces and agitated in a lysozyme and sucrose buffer for 60 minutes and underwent three freeze/thaw cycles in a Proteinase K solution. This was followed by a gentler agitation

We checked each site by taking ice cores and observing the algae biomass to determine the likelihood of krill living under the sea ice in each location. We also used a Remotely Operated Vehicle (ROV) with cameras attached to observe the abundance of krill under the sea ice. If krill were present we used on the sea ice floe a zooplankton pump, called MASMA, according to Meyer et al. 2009, whereas at the edge of the floe column a custom-built fish pump system was used to collect krill near the surface. The Aqualife Biostream BP40 fish pump was capable of pumping up to 1300 litres per minute without harming animals that pass through the pump. For much of the voyage it was operated from the ctd room and at this increased suction head it ran at about 500 litres per minute. Krill were caught at ice stations 2, 6, 7 and 8. The Krill Sample-Overview.xls file contains information regarding how many krill were caught at each ice stations, who was involved and related information. The SIPEX II Krill Voyage Report.docx contains information about the various issues that were encountered during the voyage. It also contains information from the Bottom Krill experiment, which has its own dataset and metadata record. It is duplicated in both datasets. The larvae were used for a growth experiment using the IGR method and after length measurements frozen for carbon, nitrogen, lipids, stomach and gut content analysis. The total and carapace length were determined of juveniles as well as their digestive gland size. Animals were than dissected and tissues frozen at -80C for further analysis (see above). These condition parameters will be discussed in relation to physical and biological environmental parameters of the ice floe (e.g. sea ice thickness, snow coverage, under ice topography and biomass). When this data is analysed, the dataset will be updated to include analysed versions of the data listed in the Krill Sample-Overview.xls file. Also included in the dataset are technical documents and manuals pertaining to the fish pump that was used. Meyer B et al. 2009. Limnol Oceanogr 54:1595-1614

Metadata record AAS_4127_antFOCE_SedimentFauna contains all data sets relating to the fauna sampled from marine sediments during the antFOCE experiment, including macrofauna, meiofauna, diatoms, microbes, as well as DNA sequencing conducted on some of these groups and the results of a sediment bioturbation study. Refer to antFOCE report section 4.4 for deployment, sampling and on-station analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file ‘V1 2019 Samples.xlsx’. Each sample pair consisted of one 2 L sample filtered through a 0.45 μm pore size filter, and one 12 L sample filtered through a 20 μm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 ˚C. Filters of the 12 L samples were stored whole and also frozen at -80 ˚C. DNA of all samples was extracted at the specialised lab ‘eDNA frontiers’ located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples: - A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 °C for 10 min, a 16 cycle touchdown phase (62 °C -1 °C per cycle), followed by 25 cycles with an annealing temperature of 46 °C (total of 41 cycles), and a final extension at 72 °C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 °C for 10 min, 10 cycles of 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI dual tagged’. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI fusion tagged’. - A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Fish’. - A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Mammal’. - A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer

Metadata record AAS_4127_antFOCE_EnvironmentalData contains seafloor Ambient Light and ambient Seawater Temperature data sets collected at the antFOCE site during the experiment. Ambient Light data was collected using Photosynthetically Active Radiation sensors (Odyssey Dataflow 392 photo diode light meters) distributed around the antFOCE site as well as several inside the experimental chambers and open plots. Seawater Temperature data were collected using Onset Hoboware Tidbit v2 (UTBI-001) temperature loggers attached to the outside of various pieces of the underwater experimental infrastructure across the antFOCE site. Refer to antFOCE report section 2.3 for deployment, sampling and on-station analysis details. https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127 Background The antFOCE experimental system was deployed in O'Brien Bay, approximately 5 kilometres south of Casey station, East Antarctica, in the austral summer of 2014/15. Surface and sub-surface (in water below the sea ice) infrastructure allowed controlled manipulation of seawater pH levels (reduced by 0.4 pH units below ambient) in 2 chambers placed on the sea floor over natural benthic communities. Two control chambers (no pH manipulation) and two open plots (no chambers, no pH manipulation) were also sampled to compare to the pH manipulated (acidified) treatment chambers. Details of the antFOCE experiment can be found in the report – "antFOCE 2014/15 – Experimental System, Deployment, Sampling and Analysis". This report and a diagram indicating how the various antFOCE data sets relate to each other are available at: https://data.aad.gov.au/metadata/records/AAS_4127_antFOCE_Project4127

In this data set we examined whether eDNA samples can detect similar numbers of species and community compositions as genetic continuous plankton recorder (CPR) samples. On the V4 voyage 2018 from Hobart to Macquarie island, small and large volume eDNA samples as well as genetic CPR samples were collected. All samples were sequenced with a metazoan specific cytochrome c oxidase I marker (folder "2018_08_28 eDNA V4 COI" contains all genetic CPR and small volume eDNA samples, folder "2019_05_08_eDNA_V4_CBR_Repeats_COI" contains some repeated small volume eDNA samples and all large volume eDNA samples (also called CBR samples)). Additionally, all eDNA samples were sequenced using an 18S rRNA marker (folder "2018_09_19 eDNA V4 18s Ramaciotti") to assess overall biodiversity. Each folder contains the raw sequencing data (fastq format) as well as data indexes and readme files. Please contact us if you are planning on using this data (leonie.suter@aad.gov.au). More information about these datasets are contained in the readme files in the dataset.