Cold-water coral microbiomes (Lophelia pertusa) from Gulf of Mexico and Atlantic Ocean: raw data
공공데이터포털
The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.
Cold-water coral metagenomes (Lophelia pertusa) from the Gulf of Mexico and Atlantic Ocean: raw data
공공데이터포털
In 2009, three unique colonies of the cold-water coral Lophelia pertusa were sampled in the western Atlantic Ocean to examine their microbial metagenomes. Nine additional samples were collected from three sites (Viosca Knoll 826, Viosca Knoll 906, and West Florida Slope) around the Gulf of Mexico in 2009 and 2010. Previous studies have examined the bacterial associates of this coral, but to date, no cold-water coral metagenomes have been published. This analysis characterized and identified microbial associates (bacteria, archaea, eukaryotes, viruses) associated with Lophelia, and also provided a first look at the functional and metabolic capabilities of the Lophelia microbial metagenome. Replicate sampling allowed for supplemental analysis of the variation in metagenomes between individual coral samples and among the four collection sites.
Cold-water coral microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: raw data
공공데이터포털
The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.
Cold-water coral microbiomes (Astrangia poculata) from Narragansett Bay: sequence data
공공데이터포털
The files provided in this data release are the DNA sequence files referenced in Goldsmith and others (2019), which represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of Astrangia poculata microbiomes completed using Sanger dideoxy sequencing. The coral samples were collected from Narragansett Bay at Fort Wetherill State Park, Jamestown, Rhode Island in 2015 and 2016 (Sharp and others, 2017). Sequences were obtained by first extracting DNA from a fragment of each A. poculata sample comprising mucus, tissue, and skeleton. Bacterial DNA was amplified from all samples by polymerase chain reaction (PCR), using primers 8F (5’–AGA GTT TGA TCC TGG CTC AG) and 1492R (5’–GGT TAC CTT GTT ACG ACT T) to target the 16S rDNA gene in bacteria. Archaeal DNA from two of the samples (FW1B8 and FW1W8) was amplified using primers 21F (5'–TTC CGG TTG ATC CYG CCG GA) and 958R (5'–YCC GGC GTT GAM TCC AAT T) to target the 16S rDNA gene from archaea. All amplicons were visualized on an agarose gel, extracted from the gel, quantitated, cloned into a vector, and used to transform competent cells. Inserts in positive transformants were sequenced by the Clemson University Genomics Computational Laboratory (Clemson, SC). The sequences were processed by trimming vectors and ends, removing sequences less than 50 base pairs (bp), checking for chimeras, classifying taxonomy, and removing unclassified, chloroplast, and mitochondrial sequences. After processing, 806 bacterial operational taxonomic units (OTUs) and 18 archaeal OTUs remained. Sequences representing each OTU have been deposited in the National Center for Biotechnology Information’s (NCBI) GenBank archive, and have been assigned accession numbers MK175495 through MK176300 (bacterial sequences) and MH915525 through MH915542 (archaeal sequences). Minimum information about a marker gene (MIMARKS) compliant metadata files are also included in the data download files. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.
Raw sequencing and amplicon sequence variant data from bacterial communities shed by Montastraea cavernosa coral fragments into filtered seawater mesocosms
공공데이터포털
The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) include an amplicon sequence variant (ASV) table and the raw 16S rRNA gene amplicon files from six microbial communities (Mcav17, Mcav18, McH-101, McH-103, McD-57, and McD-58) derived from mesocosms consisting of filtered seawater in which either healthy or diseased (stony coral tissue loss disease) fragments of Montastraea cavernosa had been incubated, as well as sequence files of a mock community and extraction kit blank. Mesocosms were inoculated at the Smithsonian Marine Station located in Fort Pierce, Florida, during two separate trips: one in October 2019 and the other in November 2020. The coral fragments were collected between April 2018 and November 2020, from various locations throughout the Florida Keys. Mesocosms were set up by placing the coral fragments into filtered seawater for 4-5 days and then the fragments were removed so the water could be processed. The mock community was sequenced to assess any biases in the sequencing technology, while extraction blanks were sequenced to identify any contaminants in the DNA extraction kit.
Prokaryotic Communities Shed by Diseased and Healthy Corals (Diploria labyrinthiformis, Pseudodiploria strigosa, Montastraea cavernosa, Colpophyllia natans, and Orbicella faveolata) into Filtered Seawater Mesocosms – Raw and Processed Data
공공데이터포털
The files in this data release (Kellogg and others, 2023) are those referenced in the journal article by Evans and others (2023) entitled “Investigating microbial size classes associated with the transmission of stony coral tissue loss disease (SCTLD).” They contain an amplicon sequence variant (ASV) table and the raw 16S rRNA gene amplicon files from fifty-six 0.22-micrometer (µm) pore size filters, as well as six reagent blanks, three mock communities, and a 0.22-µm-filtered ultraviolet (UV)-treated seawater (FSW) control. The 0.22 µm pore size filters contained tangential flow filtration (TFF) concentrated microbial communities derived from bucket mesocosms consisting of approximately 18 liters (L) of UV-treated FSW in which either healthy or diseased corals (Diploria labyrinthiformis, Pseudodiploria strigosa, Montastraea cavernosa, Colpophyllia natans, and Orbicella faveolata) had been incubated, and a FSW control. Colonies and fragments of apparently healthy corals were collected from Florida reefs or nurseries between April 2018 and September 2020 and transported to the Smithsonian Marine Station (SMS) in Fort Pierce, Florida. These samples were transferred to indoor, temperature-controlled water tables containing FSW and maintained along with other corals as part of the SMS long-term healthy coral stock. Corals exhibiting signs consistent with stony coral tissue loss disease (SCTLD) were collected from the reef immediately prior to each experimental run (Run 1 – October 2019, Run 2 – November 2020, and Run 3 – March 2021), and transported to SMS to be placed in individual mesocosms with weighted air lines. Apparently healthy corals of the same or similar species (i.e., same genus or family) were simultaneously transferred from the SMS healthy stock tanks into identical individual mesocosms. All mesocosms were housed within outdoor water tables containing recirculating freshwater maintained at approximately 28 degrees Celsius (°C) and located under a mesh canopy to allow some sunlight attenuation. Separate “healthy” and “diseased” water tables were maintained to prevent cross-contamination between the different mesocosm types. All corals were incubated within the mesocosms for 2-5 days to enrich the water with microbes. Following the incubation period, the corals were removed from their mesocosms, and the seawater was poured through a sterilized mesh screen (200 µm for Run 1, and 106 µm for Runs 2 and 3). The water was TFF-concentrated, then sequentially passed through a sterile 0.8 µm pore size nitrocellulose filter unit (Runs 2 and 3) and a sterile 0.22 µm pore size nitrocellulose filter unit (all three runs). The 0.22 µm pore size filters were then cut from the units using ethanol-sterilized blades, with portions frozen at -20°C for later processing. Extraction of deoxyribonucleic acid (DNA) from the samples and blanks occurred between February and May 2021 at the U.S. Geological Survey St. Petersburg Coastal and Marine Science Center (USGS SPCMSC) Coral Microbial Ecology Laboratory in St. Petersburg, FL, USA using Qiagen DNeasy PowerBiofilm kits. Library preparation and DNA sequencing were conducted on July 28th, 2021 by the Michigan State University RTSF Genomics Core (East Lansing, MI) using primers 515F: GTGCCAGCMGCCGCGGTAA and 806R: GGACTACHVGGGTWTCTAAT to target the V4 variable region of the 16S ribosomal ribonucleic acid (rRNA) gene on a MiSeq sequencing system with v2 chemistry to obtain paired-end 250-base pair (bp) reads.
Functional gene microarray data from cold-water corals (Acanthogorgia spp., Desmophyllum dianthus, Desmophyllum pertusum, and Enallopsammia profunda) from the Atlantic Ocean off the Southeast Coast of the United States–Raw Data and Sample Site Information
공공데이터포털
The files in this data release (Kellogg and Voelschow, 2023) contain normalized microarray probe intensity values from GeoChip 5.0S microarrays referenced in the journal article entitled “Functional gene composition and metabolic potential of deep-sea coral-associated microbial communities” by Pratte and others (2023). The GeoChip 5.0S microarrays, provided by Glomics Inc., contain 57,498 oligonucleotide probes that target 383 microbial (archaeal, bacterial, and fungal) genes and cover 151,797 coding sequences within the following metabolic categories: carbon, sulfur, and nitrogen cycling, as well as metal homeostasis, antibiotic resistance, and contaminant degradation. One microarray was run per coral (number of samples [n] = 11), using 400 nanograms (ng) of DNA extracted from the sample, plus a microarray run as a reagent blank (n = 1). The coral samples included one Acanthogorgia aspera, one Acanthogorgia spissa, three Desmophyllum dianthus, three Desmophyllum pertusum (formerly Lophelia pertusa) and three Enallopsammia profounda species. Corals were collected during two research cruises: the first in August 2018 and the second in April 2019, from six sites offshore of the southeastern coast of the United States in water depths ranging from 296–1567 meters (m). Coral samples were flash frozen in liquid nitrogen on the ship and stored at -80 degrees Celsius (°C) until processed. Extraction of deoxyribose nucleic acid (DNA) from the coral samples and kit blank occurred on August 5, 2019, at the Coral Microbial Ecology Laboratory in St. Petersburg, Florida (FL) using a QIAGEN DNeasy PowerBiofilm kit. Then, DNA samples were sent to Glomics Inc. on August 6, 2019, for application of GeoChip 5.0S microarrays. For more information, please see the README file and metadata files.
Functional gene microarray data from cold-water corals (Acanthogorgia spp., Desmophyllum dianthus, Desmophyllum pertusum, and Enallopsammia profunda) from the Atlantic Ocean off the Southeast Coast of the United States–Raw Data and Sample Site Information
공공데이터포털
The files in this data release (Kellogg and Voelschow, 2023) contain normalized microarray probe intensity values from GeoChip 5.0S microarrays referenced in the journal article entitled “Functional gene composition and metabolic potential of deep-sea coral-associated microbial communities” by Pratte and others (2023). The GeoChip 5.0S microarrays, provided by Glomics Inc., contain 57,498 oligonucleotide probes that target 383 microbial (archaeal, bacterial, and fungal) genes and cover 151,797 coding sequences within the following metabolic categories: carbon, sulfur, and nitrogen cycling, as well as metal homeostasis, antibiotic resistance, and contaminant degradation. One microarray was run per coral (number of samples [n] = 11), using 400 nanograms (ng) of DNA extracted from the sample, plus a microarray run as a reagent blank (n = 1). The coral samples included one Acanthogorgia aspera, one Acanthogorgia spissa, three Desmophyllum dianthus, three Desmophyllum pertusum (formerly Lophelia pertusa) and three Enallopsammia profounda species. Corals were collected during two research cruises: the first in August 2018 and the second in April 2019, from six sites offshore of the southeastern coast of the United States in water depths ranging from 296–1567 meters (m). Coral samples were flash frozen in liquid nitrogen on the ship and stored at -80 degrees Celsius (°C) until processed. Extraction of deoxyribose nucleic acid (DNA) from the coral samples and kit blank occurred on August 5, 2019, at the Coral Microbial Ecology Laboratory in St. Petersburg, Florida (FL) using a QIAGEN DNeasy PowerBiofilm kit. Then, DNA samples were sent to Glomics Inc. on August 6, 2019, for application of GeoChip 5.0S microarrays. For more information, please see the README file and metadata files.