The files in this data release (Kellogg and Voelschow, 2023) contain normalized microarray probe intensity values from GeoChip 5.0S microarrays referenced in the journal article entitled “Functional gene composition and metabolic potential of deep-sea coral-associated microbial communities” by Pratte and others (2023). The GeoChip 5.0S microarrays, provided by Glomics Inc., contain 57,498 oligonucleotide probes that target 383 microbial (archaeal, bacterial, and fungal) genes and cover 151,797 coding sequences within the following metabolic categories: carbon, sulfur, and nitrogen cycling, as well as metal homeostasis, antibiotic resistance, and contaminant degradation. One microarray was run per coral (number of samples [n] = 11), using 400 nanograms (ng) of DNA extracted from the sample, plus a microarray run as a reagent blank (n = 1). The coral samples included one Acanthogorgia aspera, one Acanthogorgia spissa, three Desmophyllum dianthus, three Desmophyllum pertusum (formerly Lophelia pertusa) and three Enallopsammia profounda species. Corals were collected during two research cruises: the first in August 2018 and the second in April 2019, from six sites offshore of the southeastern coast of the United States in water depths ranging from 296–1567 meters (m). Coral samples were flash frozen in liquid nitrogen on the ship and stored at -80 degrees Celsius (°C) until processed. Extraction of deoxyribose nucleic acid (DNA) from the coral samples and kit blank occurred on August 5, 2019, at the Coral Microbial Ecology Laboratory in St. Petersburg, Florida (FL) using a QIAGEN DNeasy PowerBiofilm kit. Then, DNA samples were sent to Glomics Inc. on August 6, 2019, for application of GeoChip 5.0S microarrays. For more information, please see the README file and metadata files.

The files in this data release (Kellogg and Voelschow, 2023) contain normalized microarray probe intensity values from GeoChip 5.0S microarrays referenced in the journal article entitled “Functional gene composition and metabolic potential of deep-sea coral-associated microbial communities” by Pratte and others (2023). The GeoChip 5.0S microarrays, provided by Glomics Inc., contain 57,498 oligonucleotide probes that target 383 microbial (archaeal, bacterial, and fungal) genes and cover 151,797 coding sequences within the following metabolic categories: carbon, sulfur, and nitrogen cycling, as well as metal homeostasis, antibiotic resistance, and contaminant degradation. One microarray was run per coral (number of samples [n] = 11), using 400 nanograms (ng) of DNA extracted from the sample, plus a microarray run as a reagent blank (n = 1). The coral samples included one Acanthogorgia aspera, one Acanthogorgia spissa, three Desmophyllum dianthus, three Desmophyllum pertusum (formerly Lophelia pertusa) and three Enallopsammia profounda species. Corals were collected during two research cruises: the first in August 2018 and the second in April 2019, from six sites offshore of the southeastern coast of the United States in water depths ranging from 296–1567 meters (m). Coral samples were flash frozen in liquid nitrogen on the ship and stored at -80 degrees Celsius (°C) until processed. Extraction of deoxyribose nucleic acid (DNA) from the coral samples and kit blank occurred on August 5, 2019, at the Coral Microbial Ecology Laboratory in St. Petersburg, Florida (FL) using a QIAGEN DNeasy PowerBiofilm kit. Then, DNA samples were sent to Glomics Inc. on August 6, 2019, for application of GeoChip 5.0S microarrays. For more information, please see the README file and metadata files.

The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.

The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.

The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and Voelschow, 2021) are the raw DNA sequence files referenced in the associated journal article (Kellogg and Pratte, 2021) entitled, “Unexpected diversity of Endozoicomonas in deep-sea corals.”. This dataset, PRJNA699458_16S-V3V4_raw_data_1.zip, represents the 16S rRNA gene amplicon surveys of 28 samples of deep-sea corals, including Acanthogorgia aspera (n=5), Acanthogorgia spissa (n=4), Desmophyllum dianthus (n=7), and Lophelia pertusa [Desmophyllum pertusum] (n=12), plus a kit extraction control blank. The sequencing targeted the V3-V4 variable region (primers 341F/806R) and was completed using an Illumina MiSeq sequencing system with version 2 chemistry to obtain paired-end reads.

The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and Voelschow, 2021) are the raw DNA sequence files referenced in the associated journal article (Kellogg and Pratte, 2021) entitled, “Unexpected diversity of Endozoicomonas in deep-sea corals.”. This dataset, PRJNA699458_16S-V3V4_raw_data_1.zip, represents the 16S rRNA gene amplicon surveys of 28 samples of deep-sea corals, including Acanthogorgia aspera (n=5), Acanthogorgia spissa (n=4), Desmophyllum dianthus (n=7), and Lophelia pertusa [Desmophyllum pertusum] (n=12), plus a kit extraction control blank. The sequencing targeted the V3-V4 variable region (primers 341F/806R) and was completed using an Illumina MiSeq sequencing system with version 2 chemistry to obtain paired-end reads.

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.

In 2009, three unique colonies of the cold-water coral Lophelia pertusa were sampled in the western Atlantic Ocean to examine their microbial metagenomes. Nine additional samples were collected from three sites (Viosca Knoll 826, Viosca Knoll 906, and West Florida Slope) around the Gulf of Mexico in 2009 and 2010. Previous studies have examined the bacterial associates of this coral, but to date, no cold-water coral metagenomes have been published. This analysis characterized and identified microbial associates (bacteria, archaea, eukaryotes, viruses) associated with Lophelia, and also provided a first look at the functional and metabolic capabilities of the Lophelia microbial metagenome. Replicate sampling allowed for supplemental analysis of the variation in metagenomes between individual coral samples and among the four collection sites.

In 2009, three unique colonies of the cold-water coral Lophelia pertusa were sampled in the western Atlantic Ocean to examine their microbial metagenomes. Nine additional samples were collected from three sites (Viosca Knoll 826, Viosca Knoll 906, and West Florida Slope) around the Gulf of Mexico in 2009 and 2010. Previous studies have examined the bacterial associates of this coral, but to date, no cold-water coral metagenomes have been published. This analysis characterized and identified microbial associates (bacteria, archaea, eukaryotes, viruses) associated with Lophelia, and also provided a first look at the functional and metabolic capabilities of the Lophelia microbial metagenome. Replicate sampling allowed for supplemental analysis of the variation in metagenomes between individual coral samples and among the four collection sites.