The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and Voelschow, 2021) are the raw DNA sequence files referenced in the associated journal article (Kellogg and Pratte, 2021) entitled, “Unexpected diversity of Endozoicomonas in deep-sea corals.”. This dataset, PRJNA699458_16S-V3V4_raw_data_1.zip, represents the 16S rRNA gene amplicon surveys of 28 samples of deep-sea corals, including Acanthogorgia aspera (n=5), Acanthogorgia spissa (n=4), Desmophyllum dianthus (n=7), and Lophelia pertusa [Desmophyllum pertusum] (n=12), plus a kit extraction control blank. The sequencing targeted the V3-V4 variable region (primers 341F/806R) and was completed using an Illumina MiSeq sequencing system with version 2 chemistry to obtain paired-end reads.

The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.

The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.

The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.

The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.

In 2009, three unique colonies of the cold-water coral Lophelia pertusa were sampled in the western Atlantic Ocean to examine their microbial metagenomes. Nine additional samples were collected from three sites (Viosca Knoll 826, Viosca Knoll 906, and West Florida Slope) around the Gulf of Mexico in 2009 and 2010. Previous studies have examined the bacterial associates of this coral, but to date, no cold-water coral metagenomes have been published. This analysis characterized and identified microbial associates (bacteria, archaea, eukaryotes, viruses) associated with Lophelia, and also provided a first look at the functional and metabolic capabilities of the Lophelia microbial metagenome. Replicate sampling allowed for supplemental analysis of the variation in metagenomes between individual coral samples and among the four collection sites.

In 2009, three unique colonies of the cold-water coral Lophelia pertusa were sampled in the western Atlantic Ocean to examine their microbial metagenomes. Nine additional samples were collected from three sites (Viosca Knoll 826, Viosca Knoll 906, and West Florida Slope) around the Gulf of Mexico in 2009 and 2010. Previous studies have examined the bacterial associates of this coral, but to date, no cold-water coral metagenomes have been published. This analysis characterized and identified microbial associates (bacteria, archaea, eukaryotes, viruses) associated with Lophelia, and also provided a first look at the functional and metabolic capabilities of the Lophelia microbial metagenome. Replicate sampling allowed for supplemental analysis of the variation in metagenomes between individual coral samples and among the four collection sites.

The files provided in this data release are the DNA sequence files referenced in Goldsmith and others (2019), which represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of Astrangia poculata microbiomes completed using Sanger dideoxy sequencing. The coral samples were collected from Narragansett Bay at Fort Wetherill State Park, Jamestown, Rhode Island in 2015 and 2016 (Sharp and others, 2017). Sequences were obtained by first extracting DNA from a fragment of each A. poculata sample comprising mucus, tissue, and skeleton. Bacterial DNA was amplified from all samples by polymerase chain reaction (PCR), using primers 8F (5’–AGA GTT TGA TCC TGG CTC AG) and 1492R (5’–GGT TAC CTT GTT ACG ACT T) to target the 16S rDNA gene in bacteria. Archaeal DNA from two of the samples (FW1B8 and FW1W8) was amplified using primers 21F (5'–TTC CGG TTG ATC CYG CCG GA) and 958R (5'–YCC GGC GTT GAM TCC AAT T) to target the 16S rDNA gene from archaea. All amplicons were visualized on an agarose gel, extracted from the gel, quantitated, cloned into a vector, and used to transform competent cells. Inserts in positive transformants were sequenced by the Clemson University Genomics Computational Laboratory (Clemson, SC). The sequences were processed by trimming vectors and ends, removing sequences less than 50 base pairs (bp), checking for chimeras, classifying taxonomy, and removing unclassified, chloroplast, and mitochondrial sequences. After processing, 806 bacterial operational taxonomic units (OTUs) and 18 archaeal OTUs remained. Sequences representing each OTU have been deposited in the National Center for Biotechnology Information’s (NCBI) GenBank archive, and have been assigned accession numbers MK175495 through MK176300 (bacterial sequences) and MH915525 through MH915542 (archaeal sequences). Minimum information about a marker gene (MIMARKS) compliant metadata files are also included in the data download files. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.