데이터셋 상세
미국
Cold-water coral microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: raw data
The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.
데이터 정보
연관 데이터
Cold-water coral microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: raw data
공공데이터포털
The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.
Cold-water coral microbiomes (Anthothela spp.) from Baltimore and Norfolk Canyons: raw and processed data
공공데이터포털
The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.
Cold-water coral microbiomes (Anthothela spp.) from Baltimore and Norfolk Canyons: raw and processed data
공공데이터포털
The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.
Cold-water coral microbiomes (Lophelia pertusa) from Gulf of Mexico and Atlantic Ocean: raw data
공공데이터포털
The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.
Cold-water coral microbiomes (Lophelia pertusa) from Gulf of Mexico and Atlantic Ocean: raw data
공공데이터포털
The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.
Cold-water coral microbiomes (Acanthogorgia spp. Desmophyllum dianthus, and Lophelia pertusa) from the Gulf of Mexico and Atlantic Ocean off the southeast coast of the United States: raw sequencing data
공공데이터포털
The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and Voelschow, 2021) are the raw DNA sequence files referenced in the associated journal article (Kellogg and Pratte, 2021) entitled, “Unexpected diversity of Endozoicomonas in deep-sea corals.”. This dataset, PRJNA699458_16S-V3V4_raw_data_1.zip, represents the 16S rRNA gene amplicon surveys of 28 samples of deep-sea corals, including Acanthogorgia aspera (n=5), Acanthogorgia spissa (n=4), Desmophyllum dianthus (n=7), and Lophelia pertusa [Desmophyllum pertusum] (n=12), plus a kit extraction control blank. The sequencing targeted the V3-V4 variable region (primers 341F/806R) and was completed using an Illumina MiSeq sequencing system with version 2 chemistry to obtain paired-end reads.
Cold-water coral microbiomes (Astrangia poculata) from Narragansett Bay: sequence data
공공데이터포털
The files provided in this data release are the DNA sequence files referenced in Goldsmith and others (2019), which represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of Astrangia poculata microbiomes completed using Sanger dideoxy sequencing. The coral samples were collected from Narragansett Bay at Fort Wetherill State Park, Jamestown, Rhode Island in 2015 and 2016 (Sharp and others, 2017). Sequences were obtained by first extracting DNA from a fragment of each A. poculata sample comprising mucus, tissue, and skeleton. Bacterial DNA was amplified from all samples by polymerase chain reaction (PCR), using primers 8F (5’–AGA GTT TGA TCC TGG CTC AG) and 1492R (5’–GGT TAC CTT GTT ACG ACT T) to target the 16S rDNA gene in bacteria. Archaeal DNA from two of the samples (FW1B8 and FW1W8) was amplified using primers 21F (5'–TTC CGG TTG ATC CYG CCG GA) and 958R (5'–YCC GGC GTT GAM TCC AAT T) to target the 16S rDNA gene from archaea. All amplicons were visualized on an agarose gel, extracted from the gel, quantitated, cloned into a vector, and used to transform competent cells. Inserts in positive transformants were sequenced by the Clemson University Genomics Computational Laboratory (Clemson, SC). The sequences were processed by trimming vectors and ends, removing sequences less than 50 base pairs (bp), checking for chimeras, classifying taxonomy, and removing unclassified, chloroplast, and mitochondrial sequences. After processing, 806 bacterial operational taxonomic units (OTUs) and 18 archaeal OTUs remained. Sequences representing each OTU have been deposited in the National Center for Biotechnology Information’s (NCBI) GenBank archive, and have been assigned accession numbers MK175495 through MK176300 (bacterial sequences) and MH915525 through MH915542 (archaeal sequences). Minimum information about a marker gene (MIMARKS) compliant metadata files are also included in the data download files. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.
Cold-water coral microbiomes (Astrangia poculata) from Narragansett Bay: sequence data
공공데이터포털
The files provided in this data release are the DNA sequence files referenced in Goldsmith and others (2019), which represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of Astrangia poculata microbiomes completed using Sanger dideoxy sequencing. The coral samples were collected from Narragansett Bay at Fort Wetherill State Park, Jamestown, Rhode Island in 2015 and 2016 (Sharp and others, 2017). Sequences were obtained by first extracting DNA from a fragment of each A. poculata sample comprising mucus, tissue, and skeleton. Bacterial DNA was amplified from all samples by polymerase chain reaction (PCR), using primers 8F (5’–AGA GTT TGA TCC TGG CTC AG) and 1492R (5’–GGT TAC CTT GTT ACG ACT T) to target the 16S rDNA gene in bacteria. Archaeal DNA from two of the samples (FW1B8 and FW1W8) was amplified using primers 21F (5'–TTC CGG TTG ATC CYG CCG GA) and 958R (5'–YCC GGC GTT GAM TCC AAT T) to target the 16S rDNA gene from archaea. All amplicons were visualized on an agarose gel, extracted from the gel, quantitated, cloned into a vector, and used to transform competent cells. Inserts in positive transformants were sequenced by the Clemson University Genomics Computational Laboratory (Clemson, SC). The sequences were processed by trimming vectors and ends, removing sequences less than 50 base pairs (bp), checking for chimeras, classifying taxonomy, and removing unclassified, chloroplast, and mitochondrial sequences. After processing, 806 bacterial operational taxonomic units (OTUs) and 18 archaeal OTUs remained. Sequences representing each OTU have been deposited in the National Center for Biotechnology Information’s (NCBI) GenBank archive, and have been assigned accession numbers MK175495 through MK176300 (bacterial sequences) and MH915525 through MH915542 (archaeal sequences). Minimum information about a marker gene (MIMARKS) compliant metadata files are also included in the data download files. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.
Coral microbiome preservation and extraction method comparison of samples collected in March and August 2018-raw data
공공데이터포털
The files in this this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) are the raw 16S ribosomal ribonucleic acid (rRNA) gene amplicon deoxyribonucleic acid (DNA) sequence files from 90 samples of tropical and cold-water corals, as well as sequence files from a mock community and extraction blanks for the kits used for DNA extraction. The mock community was sequenced in order to assess any biases in the sequencing technology, while extraction blanks were sequenced in order to identify any contaminants in the DNA extraction kits. The tropical coral samples (three species) were collected by permit (#FKNMS-2017-064) in March 2018 from a nursery in the Florida Keys National Marine Sanctuary. The cold-water coral samples (two species) were collected in August 2018 from two locations in the Atlantic Ocean.
Coral microbiome preservation and extraction method comparison of samples collected in March and August 2018-raw data
공공데이터포털
The files in this this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) are the raw 16S ribosomal ribonucleic acid (rRNA) gene amplicon deoxyribonucleic acid (DNA) sequence files from 90 samples of tropical and cold-water corals, as well as sequence files from a mock community and extraction blanks for the kits used for DNA extraction. The mock community was sequenced in order to assess any biases in the sequencing technology, while extraction blanks were sequenced in order to identify any contaminants in the DNA extraction kits. The tropical coral samples (three species) were collected by permit (#FKNMS-2017-064) in March 2018 from a nursery in the Florida Keys National Marine Sanctuary. The cold-water coral samples (two species) were collected in August 2018 from two locations in the Atlantic Ocean.