The files in this this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) are the raw 16S ribosomal ribonucleic acid (rRNA) gene amplicon deoxyribonucleic acid (DNA) sequence files from 90 samples of tropical and cold-water corals, as well as sequence files from a mock community and extraction blanks for the kits used for DNA extraction. The mock community was sequenced in order to assess any biases in the sequencing technology, while extraction blanks were sequenced in order to identify any contaminants in the DNA extraction kits. The tropical coral samples (three species) were collected by permit (#FKNMS-2017-064) in March 2018 from a nursery in the Florida Keys National Marine Sanctuary. The cold-water coral samples (two species) were collected in August 2018 from two locations in the Atlantic Ocean.

The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.

The files included in this data release are the raw and processed deoxyribonucleic acid (DNA) sequence files referenced in the journal article by Lawler and others (2016) entitled “Coral-Associated Bacterial Diversity is Conserved Across Two Deep-Sea Anthothela Species”. They represent a 16S rRNA gene amplicon survey of cold-water corals (Anthothela spp.) microbiomes completed using Roche 454 pyrosequencing with titanium reagents. The samples used in this study were collected from cold-water corals between 2012-2013, at Baltimore and Norfolk Canyons in the Atlantic Ocean. The raw data files associated with this study were also submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA), under Bioproject number PRJNA296835.

The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) include an amplicon sequence variant (ASV) table and the raw 16S rRNA gene amplicon files from six microbial communities (Mcav17, Mcav18, McH-101, McH-103, McD-57, and McD-58) derived from mesocosms consisting of filtered seawater in which either healthy or diseased (stony coral tissue loss disease) fragments of Montastraea cavernosa had been incubated, as well as sequence files of a mock community and extraction kit blank. Mesocosms were inoculated at the Smithsonian Marine Station located in Fort Pierce, Florida, during two separate trips: one in October 2019 and the other in November 2020. The coral fragments were collected between April 2018 and November 2020, from various locations throughout the Florida Keys. Mesocosms were set up by placing the coral fragments into filtered seawater for 4-5 days and then the fragments were removed so the water could be processed. The mock community was sequenced to assess any biases in the sequencing technology, while extraction blanks were sequenced to identify any contaminants in the DNA extraction kit.

The files provided in this U.S. Geological Survey (USGS) data release (Kellogg and others, 2021) include an amplicon sequence variant (ASV) table and the raw 16S rRNA gene amplicon files from six microbial communities (Mcav17, Mcav18, McH-101, McH-103, McD-57, and McD-58) derived from mesocosms consisting of filtered seawater in which either healthy or diseased (stony coral tissue loss disease) fragments of Montastraea cavernosa had been incubated, as well as sequence files of a mock community and extraction kit blank. Mesocosms were inoculated at the Smithsonian Marine Station located in Fort Pierce, Florida, during two separate trips: one in October 2019 and the other in November 2020. The coral fragments were collected between April 2018 and November 2020, from various locations throughout the Florida Keys. Mesocosms were set up by placing the coral fragments into filtered seawater for 4-5 days and then the fragments were removed so the water could be processed. The mock community was sequenced to assess any biases in the sequencing technology, while extraction blanks were sequenced to identify any contaminants in the DNA extraction kit.

The U.S. Geological Survey St. Petersburg Coastal and Marine Science Center’s (USGS SPCMSC) Core Archive in St. Petersburg, FL contains a collection of coral-reef cores collected from throughout the Florida Keys reef tract (FKRT). In a previous study (Toth and Stathakopoulos, 2019), USGS researchers analyzed the upper, Holocene (~11,700 years ago to present) sections of those cores to evaluate how the coral composition of the FKRT changed over millennial timescales. Using the same methods, USGS researchers quantified the relative composition of late Pleistocene (~116 to 74 thousand years before present; Marine Isotope Stages [MIS] 5d, 5c, 5b, and 5a) sections of the coral reef cores dated by Hsia and others (2024a,b). This data release provides metadata about the location of the cores and summarizes the relative composition of coral taxa and other carbonates and the water depths (relative to modern mean sea level) of the analyzed core intervals. The data release also provides a summary of previously unpublished data (collected by David Weinstein) on the relative composition of an older Late Pleistocene reef (growing ~130–116 thousand years before present; MIS5e) from the subaerially exposed fossil reef at Windley Key Fossil Reef Geological Park. These data are compared with Holocene and modern coral-reef assemblages on the FKRT in Toth and others (2025).

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.

The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.

The files in this data release are the raw deoxyribonucleic acid (DNA) sequence files referenced in the submitted journal article by Christina A. Kellogg, Dawn B. Goldsmith and Michael A. Gray entitled "Biogeographic comparison of Lophelia-associated bacterial communities in the western Atlantic reveals conserved core microbiome". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the coral’s microbiomes completed using Roche 454 pyrosequencing with Titanium series reagents. Samples from the Gulf of Mexico were collected in 2009 and 2010. Samples from the Atlantic Ocean were collected in 2009. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA305617. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Lophelia metadata", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; email: ckellogg@usgs.gov.